TCEAL1 (NM_001006639) Human Untagged Clone
CAT#: SC324066
TCEAL1 (untagged)-Human transcription elongation factor A (SII)-like 1 (TCEAL1), transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | p21; pp21; SIIR; WEX9 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001006639.1
CTTTGGTCGAGAGGGAAAGCAGAAGAAGTCTGCTGGTCACAGCGGGGCACCTCGAGGAGA
GGACGACTAGGAGCACACGGCCCGGAAAGGTCCAGAATAACTGTGCTTGAAGAAGAAAAT TCCCAACATGGACAAACCACGCAAAGAAAATGAAGAAGAGCCGCAGAGCGCGCCCAAGAC CGATGAGGAGAGGCCTCCGGTGGAGCACTCTCCCGAAAAGCAGTCCCCCGAGGAGCAGTC TTCGGAGGAGCAGTCCTCGGAGGAGGAGTTCTTTCCTGAGGAGCTCTTGCCTGAGCTCCT GCCTGAGATGCTCCTCTCGGAGGAGCGCCCTCCGCAGGAGGGTCTTTCCAGGAAGGACCT GTTTGAGGGGCGCCCTCCCATGGAGCAGCCTCCTTGTGGAGTAGGAAAACATAAGCTTGA AGAAGGAAGCTTTAAAGAAAGGTTGGCTCGTTCTCGCCCGCAATTTAGAGGGGACATACA TGGCAGAAATTTAAGCAATGAGGAGATGATACAGGCAGCAGATGAGCTAGAAGAGATGAA AAGAGTAAGAAACAAACTGATGATAATGCACTGGAAGGCAAAACGGAGCCGTCCTTATCC TATTTAATGTGTTCGGCCTTTAATTCTGTTTTGCCTGCTAATAGTATTGCCATTGCCACC TGGACTTTCTGTTTGCATTTTCTTAATGCCTTTTCCCATATTCTGAATTTTAACTTTTTG TGAGGCTTTATTTTAGATGTTTAGCATGTAACTCGCTTAAAGTTGAGGTTTCCCCCTAAA ATCTACAAGTTTCCCTCTTTCAGTCATGAGCCCTACACATTTGCATGAAAGATGTACATT ATATATTGTGAAACGAAAAAAGCAATTTTCAAATGGTATATATTGTATCCCATTTTTGTA AAAAAAATGTATATTTATATATTAATATGCAAAGAAAAAGCTAAAAGTATAGACTTCAAA GGCATAACAGTGGTTGTGTGGTAAGATAATAGGTGATTTTTTAAATTTTTGTTTTATCTG AATTTCTCATTTTTTCAGGACAAACGTTTTACTTGTGTTGCAAAAATATATAATGAAAAA ATCACACAATTTTGAAGAAAACTGTCAATCAGCTTATAACGACAATGTGGCACTTAATAA ATACTTGTCAGAACTTTAAAAAAAAAAAAAAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_001006639 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001006639.1, NP_001006640.1 |
RefSeq Size | 1208 bp |
RefSeq ORF | 480 bp |
Locus ID | 9338 |
UniProt ID | Q15170 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a member of the transcription elongation factor A (SII)-like (TCEAL) gene family. Members of this family may function as nuclear phosphoproteins that modulate transcription in a promoter context-dependent manner. The encoded protein is similar to transcription elongation factor A/transcription factor SII and contains a zinc finger-like motif as well as a sequence related to the transcription factor SII Pol II-binding region. It may exert its effects via protein-protein interactions with other transcriptional regulators rather than via direct binding of DNA. Multiple family members are located on the X chromosome. Alternative splicing results in multiple transcript variants encoding a single isoform. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 through 3 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201528 | TCEAL1 (Myc-DDK-tagged)-Human transcription elongation factor A (SII)-like 1 (TCEAL1), transcript variant 2 |
CNY 1,200.00 |
|
RC201528L3 | Lenti ORF clone of Human transcription elongation factor A (SII)-like 1 (TCEAL1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201528L4 | Lenti ORF clone of Human transcription elongation factor A (SII)-like 1 (TCEAL1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG201528 | TCEAL1 (tGFP-tagged) - Human transcription elongation factor A (SII)-like 1 (TCEAL1), transcript variant 2 |
CNY 4,370.00 |