United States
Germany
Japan
United Kingdom
China
FHIT (NM_002012) Human Untagged Clone
CAT＃: SC322660
FHIT (untagged)-Human fragile histidine triad gene (FHIT), transcript variant 1
CNY 1,200.00
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AP3Aase; FRA3B |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC322660
CCTCTGTTCCCGGGTCCCTCAGGCGGCCACCCAGTGGGCACACTCCCAGGCGGCGCTCCG
GCCCCGCGCTCCCTCCCTCTGCCTTTCATTCCCAGCTGTCAACATCCTGGAAGCTTTGAA GCTCAGGAAAGAAGAGAAATCCACTGAGAACAGTCTGTAAAGGTCCGTAGTGCTATCTAC ATCCAGACGGTGGAAGGGAGAGAAAGAGAAAGAAGGTATCCTAGGAATACCTGCCTGCTT AGACCCTCTATAAAAGCTCTGTGCATCCTGCCACTGAGGACTCCGAAGAGGTAGCAGTCT TCTGAAAGACTTCAACTGTGAGGACATGTCGTTCAGATTTGGCCAACATCTCATCAAGCC CTCTGTAGTGTTTCTCAAAACAGAACTGTCCTTCGCTCTTGTGAATAGGAAACCTGTGGT ACCAGGACATGTCCTTGTGTGCCCGCTGCGGCCAGTGGAGCGCTTCCATGACCTGCGTCC TGATGAAGTGGCCGATTTGTTTCAGACGACCCAGAGAGTCGGGACAGTGGTGGAAAAACA TTTCCATGGGACCTCTCTCACCTTTTCCATGCAGGATGGCCCCGAAGCCGGACAGACTGT GAAGCACGTTCACGTCCATGTTCTTCCCAGGAAGGCTGGAGACTTTCACAGGAATGACAG CATCTATGAGGAGCTCCAGAAACATGACAAGGAGGACTTTCCTGCCTCTTGGAGATCAGA GGAGGAAATGGCAGCAGAAGCCGCAGCTCTGCGGGTCTACTTTCAGTGACACAGATCCTG AATTCCAGCAAAAGAGCTATTGCCAACCAGTTTGAAGACCGCCCCCCCGCCTCTCCCCAA GAGGAACTGAATCAGCATGAAAATGCAGTTTCTTCATCTCACCATCCTGTATTCTTCAAC CAGTGATCCCCCACCTCGGTCACTCCAACTCCCTTAAAATACCTAGACCTAAACGGCTCA GACAGGCAGATTTGAGGTTTCCCCCTGTCTCCTTATTCGGCAGCCTTATGATTAAACTTC CTTCTCTGCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_002012 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002012.1, NP_002003.1 |
| RefSeq Size | 1095 bp |
| RefSeq ORF | 444 bp |
| Locus ID | 2272 |
| UniProt ID | P49789 |
| Domains | HIT |
| Protein Pathways | Non-small cell lung cancer, Purine metabolism, Small cell lung cancer |
| Gene Summary | The protein encoded by this gene is a P1-P3-bis(5'-adenosyl) triphosphate hydrolase involved in purine metabolism. This gene encompasses the common fragile site FRA3B on chromosome 3, where carcinogen-induced damage can lead to translocations and aberrant transcripts. In fact, aberrant transcripts from this gene have been found in about half of all esophageal, stomach, and colon carcinomas. The encoded protein is also a tumor suppressor, as loss of its activity results in replication stress and DNA damage. [provided by RefSeq, Aug 2017] Transcript Variant: This variant (1) encodes the longest isoform (1). Variants 1-4 all encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC207120 | FHIT (Myc-DDK-tagged)-Human fragile histidine triad gene (FHIT), transcript variant 1 |
CNY 1,200.00 |
|
| RC207120L3 | Lenti ORF clone of Human fragile histidine triad gene (FHIT), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC207120L4 | Lenti ORF clone of Human fragile histidine triad gene (FHIT), transcript variant 1, mGFP tagged |
CNY 3,600.00 |
|
| RG207120 | FHIT (tGFP-tagged) - Human fragile histidine triad gene (FHIT), transcript variant 1 |
CNY 4,370.00 |
|
| SC118885 | FHIT (untagged)-Human fragile histidine triad gene (FHIT), transcript variant 1 |
CNY 1,200.00 |
