LDHA (NM_005566) Human Untagged Clone
CAT#: SC320978
LDHA (untagged)-Human lactate dehydrogenase A (LDHA), transcript variant 1
CNY 3,600.00
Cited in 2 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GSD11; HEL-S-133P; LDHM; PIG19 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_005566.1
GGGGGTGCTGCAGCCGCTGCCGCCGATTCCGGATCTCATTGCCACGCGCCCCCGACGACC
GCCCGACGTGCATTCCCGATTCCTTTTGGTTCCAAGTCCAATATGGCAACTCTAAAGGAT CAGCTGATTTATAATCTTCTAAAGGAAGAACAGACCCCCCAGAATAAGATTACAGTTGTT GGGGTTGGTGCTGTTGGCATGGCCTGTGCCATCAGTATCTTAATGAAGGACTTGGCAGAT GAACTTGCTCTTGTTGATGTCATCGAAGACAAATTGAAGGGAGAGATGATGGATCTCCAA CATGGCAGCCTTTTCCTTAGAACACCAAAGATTGTCTCTGGCAAAGACTATAATGTAACT GCAAACTCCAAGCTGGTCATTATCACGGCTGGGGCACGTCAGCAAGAGGGAGAAAGCCGT CTTAATTTGGTCCAGCGTAACGTGAACATCTTTAAATTCATCATTCCTAATGTTGTAAAA TACAGCCCGAACTGCAAGTTGCTTATTGTTTCAAATCCAGTGGATATCTTGACCTACGTG GCTTGGAAGATAAGTGGTTTTCCCAAAAACCGTGTTATTGGAAGTGGTTGCAATCTGGAT TCAGCCCGATTCCGTTACCTGATGGGGGAAAGGCTGGGAGTTCACCCATTAAGCTGTCAT GGGTGGGTCCTTGGGGAACATGGAGATTCCAGTGTGCCTGTATGGAGTGGAATGAATGTT GCTGGTGTCTCTCTGAAGACTCTGCACCCAGATTTAGGGACTGATAAAGATAAGGAACAG TGGAAAGAGGTTCACAAGCAGGTGGTTGAGAGTGCTTATGAGGTGATCAAACTCAAAGGC TACACATCCTGGGCTATTGGACTCTCTGTAGCAGATTTGGCAGAGAGTATAATGAAGAAT CTTAGGCGGGTGCACCCAGTTTCCACCATGATTAAGGGTCTTTACGGAATAAAGGATGAT GTCTTCCTTAGTGTTCCTTGCATTTTGGGACAGAATGGAATCTCAGACCTTGTGAAGGTG ACTCTGACTTCTGAGGAAGAGGCCCGTTTGAAGAAGAGTGCAGATACACTTTGGGGGATC CAAAAGGAGCTGCAATTTTAAAGTCTTCTGATGTCATATCATTTCACTGTCTAGGCTACA ACAGGATTCTAGGTGGAGGTTGTGCATGTTGTCCTTTTTATCTGATCTGTGATTAAAGCA GTAATATTTTAAGATGGACTGGGAAAAACATCAACTCCTGAAGTTAGAAATAAGAATGGT TTGTAAAATCCACAGCTATATCCTGATGCTGGATGGTATTAATCTTGTGTAGTCTTCAAC TGGTTAGTGTGAAATAGTTCTGCCACCTCTGACGCACCACTGCCAATGCTGTACGTACTG CATTTGCCCCTTGAGCCAGGTGGATGTTTACCGTGTGTTATATAACTTCCTGGCTCCTTC ACTGAACATGCCTAGTCCAACATTTTTTCCCAGTGAGTCACATCCTGGGATCCAGTGTAT AAATCCAATATCATGTCTTGTGCATAATTCTTCCAAAGGATCTTATTTTGTGAACTATAT CAGTAGTGTACATTACCATATAATGTAAAAAGATCTACATACAAACAATGCAACCAACTA TCCAAGTGTTATACCAACTAAAACCCCCAATAAACCTTGAACAGTGAACAAAAAAAAAAA AAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_005566 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005566.1, NP_005557.1 |
RefSeq Size | 1661 bp |
RefSeq ORF | 999 bp |
Locus ID | 3939 |
UniProt ID | P00338 |
Domains | ldh |
Protein Families | Druggable Genome |
Protein Pathways | Cysteine and methionine metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Propanoate metabolism, Pyruvate metabolism |
Gene Summary | The protein encoded by this gene catalyzes the conversion of L-lactate and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. The protein is found predominantly in muscle tissue and belongs to the lactate dehydrogenase family. Mutations in this gene have been linked to exertional myoglobinuria. Multiple transcript variants encoding different isoforms have been found for this gene. The human genome contains several non-transcribed pseudogenes of this gene. [provided by RefSeq, Sep 2008] Transcript Variant: This variant (1) encodes the predominant isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Overcoming 5-Fu resistance in human non-small cell lung cancer cells by the combination of 5-Fu and cisplatin through the inhibition of glucose metabolism
,Zhao, JG;Ren, KM;Tang, J;,
Tumour Biol.
,PubMed ID 25260882
[LDHA]
|
Overexpression of Pyruvate Dehydrogenase Kinase 1 and Lactate Dehydrogenase A in Nerve Cells Confers Resistance to Amyloid ß and Other Toxins by Decreasing Mitochondrial Respiration and Reactive Oxygen Species Production
,Jordan T. Newington, Tim Rappon, Shawn Albers, Daisy Y. Wong, R. Jane Rylett, and Robert C. Cumming,
J. Biol. Chem., Oct 2012; 287: 37245 - 37258.
[LDHA]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209378 | LDHA (Myc-DDK-tagged)-Human lactate dehydrogenase A (LDHA), transcript variant 1 |
CNY 3,600.00 |
|
RC209378L1 | Lenti ORF clone of Human lactate dehydrogenase A (LDHA), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC209378L2 | Lenti ORF clone of Human lactate dehydrogenase A (LDHA), transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
RC209378L3 | Lenti ORF clone of Human lactate dehydrogenase A (LDHA), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC209378L4 | Lenti ORF clone of Human lactate dehydrogenase A (LDHA), transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
RG209378 | LDHA (tGFP-tagged) - Human lactate dehydrogenase A (LDHA), transcript variant 1 |
CNY 5,200.00 |
|
SC116656 | LDHA (untagged)-Human lactate dehydrogenase A (LDHA), transcript variant 1 |
CNY 3,600.00 |