PHC2 (NM_004427) Human Untagged Clone

CAT#: SC312947

PHC2 (untagged)-Human polyhomeotic homolog 2 (Drosophila) (PHC2), transcript variant 2



  "NM_004427" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-PHC2
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EDR2; HPH2; PH2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312947 representing NM_004427.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCTCAGGGAACGGAAACTCTGCCTCCAGCATCGCCGGCACTGCCCCCCAGAATGGTGAGAATAAA
CCACCACAGGCCATTGTGAAACCCCAAATCCTGACGCATGTTATCGAAGGGTTTGTGATCCAGGAGGGG
GCGGAGCCTTTCCCGGTGGGACGCTCGTCCCTGCTGGTGGGGAATCTCAAGAAGAAGTATGCACAGGGG
TTCCTGCCTGAGAAACTTCCACAGCAGGATCACACCACCACCACTGACTCGGAGATGGAGGAGCCCTAT
CTGCAAGAATCCAAAGAGGAGGGTGCTCCCCTCAAACTCAAGTGTGAGCTCTGTGGCCGGGTGGACTTT
GCCTATAAGTTCAAGCGTTCCAAGCGCTTCTGTTCCATGGCTTGTGCAAAGAGGTACAACGTGGGATGC
ACCAAACGGGTGGGACTTTTCCACTCAGACCGGAGCAAGCTGCAGAAGGCAGGAGCTGCGACCCACAAC
CGCCGTCGGGCCAGCAAAGCCAGTCTGCCACCACTTACCAAGGATACCAAGAAGCAGCCAACAGGCACT
GTGCCCCTTTCGGTTACTGCTGCTTTGCAGCTAACACACAGCCAGGAAGACTCCAGCCGTTGCTCAGAT
AACTCAAGCTATGAGGAACCCTTGTCACCCATCTCAGCCAGCTCATCTACTTCCCGCCGGCGACAAGGC
CAGCGGGACCTGGAGCTCCCCGACATGCATATGCGGGACCTGGTGGGCATGGGACACCACTTCCTGCCA
AGTGAGCCCACCAAGTGGAATGTAGAAGACGTCTACGAATTCATCCGCTCTCTGCCAGGCTGCCAGGAG
ATAGCAGAGGAATTCCGTGCCCAGGAAATCGACGGGCAAGCCCTGCTGCTGCTCAAGGAGGACCACCTG
ATGAGCGCCATGAACATCAAGCTGGGGCCCGCCCTGAAGATCTACGCCCGCATCAGCATGCTCAAGGAC
TCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_004427
Insert Size 972 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004427.3
RefSeq Size 2566 bp
RefSeq ORF 972 bp
Locus ID 1912
UniProt ID Q8IXK0
MW 35.8 kDa
Gene Summary In Drosophila melanogaster, the 'Polycomb' group (PcG) of genes are part of a cellular memory system that is responsible for the stable inheritance of gene activity. PcG proteins form a large multimeric, chromatin-associated protein complex. The protein encoded by this gene has homology to the Drosophila PcG protein 'polyhomeotic' (Ph) and is known to heterodimerize with EDR1 and colocalize with BMI1 in interphase nuclei of human cells. The specific function in human cells has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (b) has a shorter N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...