SPFH2 (ERLIN2) (AK091697) Human Untagged Clone

CAT#: SC312333

(untagged)-Human cDNA FLJ34378 fis, clone FEBRA2018051



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ERLIN2 Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK091697, the custom clone sequence may differ by one or more nucleotides
ATGGCCGTAGCTGGCCGCCAGGGATCGCCCGCGACTTGGTCGGTGCGGTCCTGGACCTCG
GTCTTGGGTATCCGTCCTGGGGCTGGGGATGAGGGCGGTGTTGGTGGGAGCTCCCCGAGA
GCGAGCGGCAGGACGCGCATGCCCCGGAGTACTGAGACCCAGGGCGAACCTTTCCAAGGC
GTTGACTTTGGGGATTGCTCCGGATTTCCTTCTGCATTAGGCCGAACCTGGTTCGTTTTG
GTTTTTTTAGAGACAAGGTCTCGCTCTTTTGCCCAGGCTGGAGTGCAGTGGCACGATCAT
AGCTCACTACAGCCTCGAACTCCTGGGCTTAAGCGATCCTCCCACCTCACCCTGCTGAGT
AGCTGGGACCACAGGCGCACGCCACGACACTTGACAATTTTATTTTTAGTAAAGACAGGG
TCTTGGTATTTCTGGTCTCAAACTCTGGCTTCAAGCAATCCTCCTGCCTCGGCCTCCCAA
ACTGCTGGGATTACAGGCATGAGCCACCATGCGCGGCCTTTTTTTTTTTTCTCTCCT
Restriction Sites Please inquire     
ACCN AK091697
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq AK091697.1
RefSeq Size 2088 bp
RefSeq ORF 2088 bp
Locus ID 11160
Gene Summary This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...