United States
Germany
Japan
United Kingdom
China
CLEC9A (NM_207345) Human Untagged Clone
CAT＃: SC308466
CLEC9A (untagged)-Human C-type lectin domain family 9, member A (CLEC9A)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD370; DNGR-1; DNGR1; UNQ9341 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_207345 edited
GCACCTTAGACATGCACGAGGAAGAAATATACACCTCTCTTCAGTGGGATAGCCCAGCAC CAGACACTTACCAGAAATGTCTGTCTTCCAACAAATGTTCAGGAGCATGCTGTCTTGTGA TGGTGATTTCATGTGTTTTCTGCATGGGATTATTAACAGCATCCATTTTCTTGGGCGTCA AGTTGTTGCAGGTGTCCACCATTGCGATGCAGCAGCAAGAAAAACTCATCCAACAAGAGA GGGCACTGCTAAACTTTACAGAATGGAAGAGAAGCTGTGCCCTTCAGATGAAATATTGCC AAGCCTTCATGCAAAACTCATTAAGTTCAGCCCATAACAGCAGTCCTTGTCCAAACAATT GGATTCAGAACAGAGAAAGTTGTTACTATGTCTCTGAAATTTGGAGCATTTGGCACACCA GTCAAGAGAATTGTTTAAAGGAAGGTTCCACGCTGCTACAAATAGAGAGCAAAGAAGAAA TGGATTTTATCACTGGCAGCTTGAGGAAGATTAAAGGAAGCTATGATTACTGGGTGGGGT TGTCTCAGGATGGACACAGCGGACGCTGGCTTTGGCAAGATGGCTCCTCTCCTTCTCCTG GCCTGTTGCCAGCAGAGAGATCCCAGTCAGCTAACCAAGTCTGTGGATACGTGAAAAGCA ATTCCCTTCTTTCGTCTAACTGCAGCACGTGGAAGTATTTTATCTGTGAGAAGTATGCGT TGAGATCCTCTGTCTGAAAGAAATTG |
| Restriction Sites | Please inquire |
| ACCN | NM_207345 |
| Insert Size | 800 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_207345.1, NP_997228.1 |
| RefSeq Size | 1674 bp |
| RefSeq ORF | 726 bp |
| Locus ID | 283420 |
| UniProt ID | Q6UXN8 |
| Protein Families | Transmembrane |
| Gene Summary | CLEC9A is a group V C-type lectin-like receptor (CTLR) that functions as an activation receptor and is expressed on myeloid lineage cells (Huysamen et al., 2008 [PubMed 18408006]).[supplied by OMIM, Aug 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217845 | CLEC9A (Myc-DDK-tagged)-Human C-type lectin domain family 9, member A (CLEC9A) |
CNY 3,600.00 |
|
| RC217845L1 | Lenti ORF clone of Human C-type lectin domain family 9, member A (CLEC9A), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC217845L2 | Lenti ORF clone of Human C-type lectin domain family 9, member A (CLEC9A), mGFP tagged |
CNY 5,890.00 |
|
| RC217845L3 | Lenti ORF clone of Human C-type lectin domain family 9, member A (CLEC9A), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC217845L4 | Lenti ORF clone of Human C-type lectin domain family 9, member A (CLEC9A), mGFP tagged |
CNY 6,000.00 |
|
| RG217845 | CLEC9A (tGFP-tagged) - Human C-type lectin domain family 9, member A (CLEC9A) |
CNY 5,200.00 |
