WWP2 (NM_199423) Human Untagged Clone

CAT#: SC307968

WWP2 (untagged)-Human WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant 3



  "NM_199423" in other vectors (6)

CNY 5,420.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-WWP2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AIP2; WWp2-like
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307968 representing NM_199423.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCATCTGCCAGCTCTAGCCGGGCAGGAGTGGCCCTGCCTTTTGAGAAGTCTCAGCTCACTTTGAAA
GTGGTGTCCGCAAAGCCCAAGGTGCATAATCGTCAACCTCGAATTAACTCCTACGTGGAGGTGGCGGTG
GATGGACTCCCCAGTGAGACCAAGAAGACTGGGAAGCGCATTGGGAGCTCTGAGCTTCTCTGGAATGAG
ATCATCATTTTGAATGTCACGGCACAGAGTCATTTAGATTTAAAGGTCTGGAGCTGCCATACCTTGAGA
AATGAACTGCTAGGCACCGCATCTGTCAACCTCTCCAACGTCTTGAAGAACAATGGGGGCAAAATGGAG
AACATGCAGCTGACCCTGAACCTGCAGACGGAGAACAAAGGCAGCGTTGTCTCAGGCGGAGAGCTGACA
ATTTTCCTGGACGGGCCAACTGTTGATCTGGGAAATGTGCCTAATGGCAGTGCCCTGACAGATGGATCA
CAGCTGCCTTCGAGAGACTCCAGTGGAACAGCAGTAGCTCCAGAGAACCGGCACCAGCCCCCCAGCACA
AACTGCTTTGGTGGAAGATCCCGGACGCACAGACATTCGGGTGCTTCAGCCAGAACAACCCCAGCAACC
GGCGAGCAAAGCCCCGGTGCTCGGAGCCGGCACCGCCAGCCCGTCAAGAACTCAGGCCACAGTGGCTTG
GCCAATGGCACAGTGAATGATGAACCCACAACAGCCACTGATCCCGAAGAACCTTCCGTTGTTGGTGTG
ACGTCCCCACCTGCTGCACCCTTGAGTGTGACCCCGAATCCCAACACGACTTCTCTCCCTGCCCCAGCC
ACACCGGCTGAAGGAGAGGAACCCAGCACTTCGGGTACACAGCAGCTCCCAGCGGCTGCCCAGGCCCCC
GACGCTCTGCCTGCTGGATGGGAACAGCGAGAGCTGCCCAACGGACGTGTCTATTATGTTGACCACAAT
ACCAAGACCACCACCTGGGAGCGGCCCCTTCCTCCAGGGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_199423
Insert Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_199423.1
RefSeq Size 2659 bp
RefSeq ORF 1008 bp
Locus ID 11060
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis
MW 35.2 kDa
Gene Summary This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (3) lacks several 3' exons but has an alternate and much shorter 3' end, as compared to variant 1. The encoded isoform 3 is 3' truncated and thus lacks three WW domains and a HECT domain in the C-terminal region, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...