United States
Germany
Japan
United Kingdom
China
MAP1LC3A (NM_181509) Human Untagged Clone
CAT＃: SC307290
MAP1LC3A (untagged)-Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ATG8E; LC3; LC3A; MAP1ALC3; MAP1BLC3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC307290 representing NM_181509.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGATGAGATTCTTCAGTTCTCCATGTGGAAAAGCAGCTGTGGACCCAGCCGACCGCTGTAAGGAG GTACAGCAGATCCGCGACCAGCACCCCAGCAAAATCCCGGTGATCATCGAGCGCTACAAGGGTGAGAAG CAGCTGCCCGTCCTGGACAAGACCAAGTTTTTGGTCCCGGACCATGTCAACATGAGCGAGTTGGTCAAG ATCATCCGGCGCCGCCTGCAGCTGAACCCCACGCAGGCCTTCTTCCTGCTGGTGAACCAGCACAGCATG GTGAGTGTGTCCACGCCCATCGCGGACATCTACGAGCAGGAGAAAGACGAGGACGGCTTCCTCTATATG GTCTACGCCTCCCAGGAAACCTTCGGCTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_181509 |
| Insert Size | 378 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_181509.2 |
| RefSeq Size | 994 bp |
| RefSeq ORF | 378 bp |
| Locus ID | 84557 |
| UniProt ID | Q9H492 |
| MW | 14.5 kDa |
| Gene Summary | MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. The protein encoded by this gene is one of the light chain subunits and can associate with either MAP1A or MAP1B. Two transcript variants encoding different isoforms have been found for this gene. The expression of variant 1 is suppressed in many tumor cell lines, suggesting that may be involved in carcinogenesis. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1, resulting in an isoform (b) which has a distinct N-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220473 | MAP1LC3A (Myc-DDK-tagged)-Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 2 |
CNY 1,200.00 |
|
| RC220473L1 | Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC220473L2 | Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC220473L3 | Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC220473L4 | Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG220473 | MAP1LC3A (tGFP-tagged) - Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 2 |
CNY 2,800.00 |
其它MAP1LC3A产品
