Achaete scute homolog 3 (ASCL3) (NM_020646) Human Untagged Clone
CAT#: SC304791
ASCL3 (untagged)-Human achaete-scute complex homolog 3 (Drosophila) (ASCL3)
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHa42; HASH3; SGN1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_020646 edited
ATGATGGACAACAGAGGCAACTCTAGTCTACCTGACAAACTTCCTATCTTCCCTGATTCT GCCCGCTTGCCACTGACCAGGTCCTTCTATCTGGAGCCCATGGTCACTTTCCACGTGCAC CCAGAGGCCCCGGTGTCATCCCCTTACTCTGAGGAGCTGCCACGGCTGCCTTTTCCCAGC GACTCTCTTATCCTGGGAAATTACAGTGAACCCTGCCCCTTCTCTTTCCCGATGCCTTAT CCAAATTACAGAGGGTGCGAGTACTCCTACGGGCCAGCCTTCACCCGGAAAAGGAATGAG CGGGAAAGGCAGCGGGTGAAATGTGTCAATGAAGGCTATGCCCAGCTCCGCCATCATCTG CCAGAGGAGTATTTGGAGAAGCGACTCAGCAAAGTGGAAACCCTCAGAGCTGCGATCAAG TACATTAACTACCTGCAGTCTCTTCTGTACCCTGATAAAGCTGAGACCAAGAATAACCCT GGAAAAGTTTCCTCCATGATAGCAACCACCAGCCACCATGCTGACCCTATGTTCAGAATT GTTTGA |
Restriction Sites | Please inquire |
ACCN | NM_020646 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_020646.1, NP_065697.1 |
RefSeq Size | 650 bp |
RefSeq ORF | 546 bp |
Locus ID | 56676 |
UniProt ID | Q9NQ33 |
Gene Summary | Basic helix-loop-helix transcription factors, such as ASCL3, are essential for the determination of cell fate and the development and differentiation of numerous tissues (Jonsson et al., 2004 [PubMed 15475265]).[supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220042 | ASCL3 (Myc-DDK-tagged)-Human achaete-scute complex homolog 3 (Drosophila) (ASCL3) |
CNY 2,400.00 |
|
RC220042L1 | Lenti ORF clone of Human achaete-scute complex homolog 3 (Drosophila) (ASCL3), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC220042L2 | Lenti ORF clone of Human achaete-scute complex homolog 3 (Drosophila) (ASCL3), mGFP tagged |
CNY 5,890.00 |
|
RC220042L3 | Lenti ORF clone of Human achaete-scute complex homolog 3 (Drosophila) (ASCL3), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220042L4 | Lenti ORF clone of Human achaete-scute complex homolog 3 (Drosophila) (ASCL3), mGFP tagged |
CNY 5,890.00 |
|
RG220042 | ASCL3 (tGFP-tagged) - Human achaete-scute complex homolog 3 (Drosophila) (ASCL3) |
CNY 4,000.00 |
其它Achaete scute homolog 3产品