PLAAT2 (NM_017878) Human Untagged Clone
CAT#: SC304539
HRASLS2 (untagged)-Human HRAS-like suppressor 2 (HRASLS2)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HRASLS2; PLA1/2-2; PLAAT-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_017878 edited
ATGGCTTTGGCCAGACCAAGACCGAGACTTGGAGACCTGATTGAGATTTCTCGCTTTGGC TATGCACACTGGGCCATCTACGTGGGAGATGGCTATGTGGTCCATCTGGCTCCGGCAAGT GAAATTGCTGGAGCTGGTGCGGCCAGTGTCCTGTCTGCCCTGACCAACAAAGCCATAGTG AAGAAGGAACTGCTGTCTGTGGTGGCTGGGGGAGACAACTACAGGGTCAATAACAAGCAC GATGACAGATACACACCACTGCCTTCCAACAAAATCGTCAAGCGGGCAGAGGAGTTGGTG GGGCAGGAGTTGCCTTATTCGCTGACCAGTGACAACTGCGAGCACTTCGTGAACCATCTG CGCTATGGCGTCTCCCGCAGTGACCAGGTCACTGGTGCAGTCACGACAGTAGGTGTGGCA GCAGGCCTGCTGGCTGCCGCAAGCCTTGTGGGGATCCTGCTGGCCAGAAGCAAGCGGGAA AGGCAATAA |
Restriction Sites | Please inquire |
ACCN | NM_017878 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_017878.1, NP_060348.1 |
RefSeq Size | 785 bp |
RefSeq ORF | 489 bp |
Locus ID | 54979 |
UniProt ID | Q9NWW9 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The protein encoded by this gene has both phospholipase and acyltransferase activities and acts as a tumor suppressor. The encoded protein can hydrolyze dipalmitoylated phosphatidylcholine (PC) to palmitic acid and lyso-PC. In addition, this protein can catalyze the N-acylation of phosphatidylethanolamine and can catalyze the O-acylation of lyso-PC to form PC. [provided by RefSeq, Jul 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212578 | HRASLS2 (Myc-DDK-tagged)-Human HRAS-like suppressor 2 (HRASLS2) |
CNY 3,705.00 |
|
RC212578L1 | Lenti ORF clone of Human HRAS-like suppressor 2 (HRASLS2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212578L2 | Lenti ORF clone of Human HRAS-like suppressor 2 (HRASLS2), mGFP tagged |
CNY 5,890.00 |
|
RC212578L3 | Lenti ORF clone of Human HRAS-like suppressor 2 (HRASLS2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212578L4 | Lenti ORF clone of Human HRAS-like suppressor 2 (HRASLS2), mGFP tagged |
CNY 5,890.00 |
|
RG212578 | HRASLS2 (tGFP-tagged) - Human HRAS-like suppressor 2 (HRASLS2) |
CNY 4,370.00 |