United States
Germany
Japan
United Kingdom
China
Histone H2A Bbd (H2AFB1) (NM_001017990) Human Untagged Clone
CAT＃: SC302109
H2AFB1 (untagged)-Human H2A histone family, member B1 (H2AFB1)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | H2A.B; H2A.Bbd; H2AFB1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302109 representing NM_001017990.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCGAGGAGGAGGAGACGCCGAGGGTCCTCCGGTGCTGGCGGCCGGGGGCGGACCTGCTCTCGCACC GTCCGAGCGGAGCTTTCGTTTTCAGTGAGCCAGGTGGAGCGCAGTCTACGGGAGGGCCACTACGCTCAG CGCCTGAGTCGCACGGCGCCGGTCTACCTCGCTGCGGTTATTGAGTACCTGACGGCCAAGGTCCCGGAG CTGGCGGGCAACGAGGCCCAGAACAGCGGAGAGCGGAACATCACTCCCCTGCTGCTGGACATGGTGGTT CACAACGACAGGCTACTGAGCACCCTTTTCAACACGACCACCATCTCTCAAGTGGCCCCTGGCGAGGAC TAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001017990 |
| Insert Size | 348 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001017990.1 |
| RefSeq Size | 517 bp |
| RefSeq ORF | 348 bp |
| Locus ID | 474382 |
| UniProt ID | P0C5Y9 |
| Protein Pathways | Systemic lupus erythematosus |
| MW | 12.7 kDa |
| Gene Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. This gene is part of a region that is repeated three times on chromosome X, once in intron 22 of the F8 gene and twice closer to the Xq telomere. This record represents the most centromeric copy which is in intron 22 of the F8 gene. [provided by RefSeq, Oct 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216020 | H2AFB1 (Myc-DDK-tagged)-Human H2A histone family, member B1 (H2AFB1) |
CNY 1,200.00 |
|
| RC216020L3 | Lenti ORF clone of Human H2A histone family, member B1 (H2AFB1), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC216020L4 | Lenti ORF clone of Human H2A histone family, member B1 (H2AFB1), mGFP tagged |
CNY 5,890.00 |
|
| RG216020 | H2AFB1 (tGFP-tagged) - Human H2A histone family, member B1 (H2AFB1) |
CNY 4,370.00 |
其它Histone H2A Bbd产品
