GOSR1 (NM_001007025) Human Untagged Clone

CAT#: SC301134

GOSR1 (untagged)-Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 2



  "NM_001007025" in other vectors (6)

CN¥ 3,990.00


货期*
2周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-GOSR1 Antibody
    • 100 ul

CN¥ 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GOLIM2; GOS-28; GOS28; GOS28/P28; GS28; P28
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001007025 edited
CAAAGATGGCGGCAGGGACCAGCAGTTACTGGGAAGATCTCAGGAAACAGGCTCGACAGC
TGGAAAATGAACTTGACCTGAAACTAGTTTCCTTCAGCAAACTATGTACAAGTTACAGTC
ATAGCAGTACCCGAGATGGAAGACGCGACAGTTCTGATACAACACCCCTTTTAAATGGAT
CAAGCCAAGACAGAATGTTTGAGACAATGGCGATTGAGATTGAACAACTTTTGGCAAGGC
TTACAGGGGTAAATGATAAAATGGCAGAATATACCAACAGTGCAGGTGTCCCCTCCTTGA
ATGCAGCCCTGATGCATACATTACAGCGGCATAGAGACATATTGCAGGATTATACACATG
AATTCCATAAAACCAAAGCAAACTTTATGGCAATACGGGAAAGGGAGAATCTTATGGGAT
CAGTACGAAAAGATATTGAGTCATATAAAAGTGGGTCTGGAGTAAACAACAGAAGAACTG
AGCTATTTTTGAAAGAACATGACCACCTTCGAAACTCAGATCGTCTGATAGAAGAGACAA
TAAGCATTGCTATGGCAACAAAAGAAAATATGACTTCACAGAGAGGAATGTTGAAGTCAA
TTCACAGCAAAATGAACACTTTGGCCAATCGTTTTCCTGCTGTAAACAGCCTGATCCAGA
GGATCAACCTGAGGAAGCGGCGGGACTCGCTCATCCTAGGGGGTGTTATTGGGATCTGTA
CCATCCTGTTGCTGCTGTATGCGTTCCATTGATGGGACATCTTCAGGGACTCTTGACAGC
CACCGCTTTCACACCCTGGTCTGGAATAAGGAAACATCGGAGGGAGAAGTTGACTGTCTT
GATAATTAGCCTGACCAGCAGGATGAATGCAAGACTGACAGTGATGGACTCTGTGACATG
GTCAGGTTGAGCTGAAGCCACAGTTTCTCTGTGCTGTGTTTTCTAACACATAATCTGTTT
TTAATAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001007025
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001007025.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001007025.1, NP_001007026.1
RefSeq Size 5224 bp
RefSeq ORF 747 bp
Locus ID 9527
UniProt ID O95249
Protein Families Druggable Genome, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
Gene Summary This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an in-frame small segment of 6 nts in the 5' coding region, as compared to variant 1. The encoded isoform 2 thus lacks internal 2 aa, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...