United States
Germany
Japan
United Kingdom
China
MBD2 (NM_015832) Human Untagged Clone
CAT＃: SC110013
MBD2 (untagged)-Human methyl-CpG binding domain protein 2 (MBD2), transcript variant 2
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DMTase; NY-CO-41 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_015832 edited
GCGCGCCGCGCTGCGGGCGGGGCGGGTCTCCGGGATTCCAAGGGCTCGGTTACGGAAGAA GCGCAGCGCCGGCTGGGGAGGGGGCTGGATGCGCGCGCACCCGGGGGGAGGCCGCTGCTG CCCGGAGCAGGAGGAGGGGGAGAGTGCGGCGGGCGGCAGCGGCGCTGGCGGCGACTCCGC CATAGAGCAGGGGGGCCAGGGCAGCGCGCTCGCCCCGTCCCCGGTGAGCGGCGTGCGCAG GGAAGGCGCTCGGGGCGGCGGCCGTGGCCGGGGGCGGTGGAAGCAGGCGGGCCGGGGCGG CGGCGTCTGTGGCCGTGGCCGGGGCCGGGGCCGTGGCCGGGGACGGGGACGGGGCCGGGG CCGGGGCCGCGGCCGTCCCCCGAGTGGCGGCAGCGGCCTTGGCGGCGACGGCGGCGGCTG CGGCGGCGGCGGCAGCGGTGGCGGCGGCGCCCCCCGGCGGGAGCCGGTCCCTTTCCCGTC GGGGAGCGCGGGGCCGGGGCCCAGGGGACCCCGGGCCACGGAGAGCGGGAAGAGGATGGA TTGCCCGGCCCTCCCCCCCGGATGGAAGAAGGAGGAAGTGATCCGAAAATCTGGGCTAAG TGCTGGCAAGAGCGATGTCTACTACTTCAGTCCAAGTGGTAAGAAGTTCAGAAGCAAGCC TCAGTTGGCAAGGTACCTGGGAAATACTGTTGATCTCAGCAGTTTTGACTTCAGAACTGG AAAGATGATGCCTAGTAAATTACAGAAGAACAAACAGAGACTGCGAAACGATCCTCTCAA TCAAAATAAGCTGCGCTGGAACACTCATCGTCCTGCACCATGGCATGCGCTTTCAAGACT CTGCTTGCTCATACGCTGTTTGCTCTGCTTGGAATGTGCTTACCCCCTTCCCCTTCATCT GGTGAACTCCTACTCATCCAAGACCCAGCTTCATTGTCTCCATCTCTGGGAAGCCTGCCC TGCATACTCCAGGCAGAACCAATCCTTTCCTCCATAATCTAGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_015832 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_015832.3. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_015832.3, NP_056647.1 |
| RefSeq Size | 1357 bp |
| RefSeq ORF | 909 bp |
| Locus ID | 8932 |
| UniProt ID | Q9UBB5 |
| Domains | MBD |
| Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
| Gene Summary | DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. The protein encoded by this gene may function as a mediator of the biological consequences of the methylation signal. It is also reported that the this protein functions as a demethylase to activate transcription, as DNA methylation causes gene silencing. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (2) includes an alternate exon in the 3' coding region, compared to variant 1, resulting in a shorter protein (testis-specific) that has a shorter C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218349 | MBD2 (Myc-DDK-tagged)-Human methyl-CpG binding domain protein 2 (MBD2), transcript variant 2 |
CNY 3,600.00 |
|
| RC218349L3 | Lenti ORF clone of Human methyl-CpG binding domain protein 2 (MBD2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RG218349 | MBD2 (tGFP-tagged) - Human methyl-CpG binding domain protein 2 (MBD2), transcript variant 2 |
CNY 4,370.00 |
