SELK (SELENOK) (NM_021237) Human Untagged Clone

CAT#: SC100671

SELK (untagged)-Human selenoprotein K (SELK) (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)



  "NM_021237" in other vectors (3)

CNY 3,432.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal SELK Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Synonyms HSPC030; HSPC297; SELK
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC100671 sequence for NM_021237 edited (data generated by NextGen Sequencing)
ATGGTTTACATCTCGAACGGACAAGTGTTGGACAGCCGGAGTCAGTCTCCATGGAGATTA
TCTTTGATAACAGATTTCTTCTGGGGAATAGCTGAGTTTGTGGTTTTGTTTTTCAAAACT
CTGCTTCAGCAAGATGTGAAAAAAAGAAGAAGCTATGGAAACTCATCTGATTCCAGATAT
GATGATGGAAGAGGGCCACCAGGAAACCCTCCCCGAAGAATGGGTAGAATCAATCATCTG
CGTGGCCCTAGTCCCCCTCCAATGGCTGGTGGATGAGGAAGGTAA

Clone variation with respect to NM_021237.3
>OriGene 5' read for NM_021237 unedited
GTAATACGACTTACTATAGGGCGGCNCGCGAATTCGCACGAGGGCAGAGGGAGATACAGA
AACCGACAGGGGCCAGGCGCCCGGTGGCTCCGAAGCGGGGAAGTGGGACAAGATGGTTTA
CATCTCGAACGGACAAGTGTTGGACAGCCGGAGTCAGTCTCCATGGAGATTATCTTTGAT
AACAGATTTCTTCTGGGGAATAGCTGAGTTTGTGGTTTTGTTTTTCAAAACTCTGCTTCA
GCAAGATGTGAAAAAAAGAAGAAGCTATGGAAACTCATCTGATTCCAGATATGATGATGG
AAGAGGGCCACCAGGAAACCCTCCCCGAAGAATGGGTAGAATCAATCATCTGCGTGGCCC
TAGTCCCCCTCCAATGGCTGGTGGATGAGGAAGGTAAATGTCTGCTCTAAGAAGCAGACA
ACCGGACATGCGCATTCATAGCAGAAGGAAACCATCAAGAAGTGGAAGGCTGACCATGAT
GAGCAGTAGATGAATGTGTATGTCTAAACAAGGACTGCTCTGTGTCCTCACAGATGAATG
AGGTCATGCTGGGAATTCCCTCTGCAGGGAACTGGCCTGACTGACATGCAGTTCCATAAA
TGCAGATGTTTGTCTCATTACCTTTTTGTATAGTTTATTAAAGTATTAATATAGTTTTAA
TAAGTAAATATTTTTAGGTTGCAGAATGGACTCCTCATCTTTATATTCACGAANAAGCAA
TCTGAAGAAAAACAATANAGCCTGTGTATTTAGCACTGGTAGTGTCACCTTTTTCACTTC
TGAAACACTGGTCATTGGTAACTTTNTCTCATTTATAATCACTGTATTTATTTAGTAGTA
TGCATAGCATATCTGTGCTCTTGAATTAATTTTTATCTTTACATAATTGNCTCATCCATC
TTAATACACTGNGTCTAATTTGCTACAA
Restriction Sites NotI-NotI     
ACCN NM_021237
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021237.3, NP_067060.2
RefSeq Size 832 bp
Locus ID 58515
UniProt ID Q9Y6D0
Protein Families Transmembrane
Gene Summary The protein encoded by this gene belongs to the selenoprotein K family. It is a transmembrane protein that is localized in the endoplasmic reticulum (ER), and is involved in ER-associated degradation (ERAD) of misfolded, glycosylated proteins. It also has a role in the protection of cells from ER stress-induced apoptosis. Knockout studies in mice show the importance of this gene in promoting Ca(2+) flux in immune cells and mounting effective immune response. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Pseudogenes of this locus have been identified on chromosomes 6 and 19.[provided by RefSeq, Aug 2017]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...