Zfand5 (NM_001106356) Rat Untagged Clone
CAT#: RN213513
Zfand5 (untagged ORF) - Rat zinc finger, AN1-type domain 5 (Zfand5), (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Zfp216 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN213513 representing NM_001106356
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACAGAAATGAGCATTTCAAGAGAGGACAAAATAACCTCCCCGAAAACAGAGGTGTCAGAGCCAGTTG TCACTCAGCCCAGTCCATCAGTTTCTCAGCCCAGTTCTTCTCAAAGTGAAGAAAAAGCTCCTGAGTTGCC CAAACCAAAGAAGAACAGATGTTTTATGTGTAGAAAGAAAGTTGGCCTTACAGGGTTTGACTGCCGATGT GGAAATTTGTTTTGTGGACTTCACCGTTACTCTGACAAGCACAACTGTCCTTATGATTACAAAGCAGAAG CTGCAGCAAAAATCAGAAAAGAAAATCCAGTTGTTGTGGCTGAAAAAATCCAGAGAATATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001106356 |
Insert Size | 342 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001106356.1, NP_001099826.1 |
RefSeq Size | 2755 bp |
RefSeq ORF | 342 bp |
Locus ID | 293960 |
Gene Summary | Involved in protein degradation via the ubiquitin-proteasome system. May act by anchoring ubiquitinated proteins to the proteasome. Plays a role in ubiquitin-mediated protein degradation during muscle atrophy. Plays a role in the regulation of NF-kappa-B activation and apoptosis. Inhibits NF-kappa-B activation triggered by overexpression of RIPK1 and TRAF6 but not of RELA. Inhibits also tumor necrosis factor (TNF), IL-1 and TLR4-induced NF-kappa-B activation in a dose-dependent manner. Overexpression sensitizes cells to TNF-induced apoptosis. Is a potent inhibitory factor for osteoclast differentiation (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR213513 | Zfand5 (Myc-DDK-tagged ORF) - Rat zinc finger, AN1-type domain 5 (Zfand5), (10 ug) |
CNY 3,990.00 |
|
RR213513L3 | Lenti ORF clone of Zfand5 (Myc-DDK-tagged ORF) - Rat zinc finger, AN1-type domain 5 (Zfand5), (10 ug) |
CNY 6,080.00 |
|
RR213513L4 | Lenti ORF clone of Zfand5 (mGFP-tagged ORF) - Rat zinc finger, AN1-type domain 5 (Zfand5), (10 ug) |
CNY 6,650.00 |