Myl2 (NM_001035252) Rat Untagged Clone
CAT#: RN202291
Myl2 (untagged ORF) - Rat myosin, light polypeptide 2, regulatory, cardiac, slow (Myl2), (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Mlc-2; MLC-2s/v; Mlc2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN202291 representing NM_001035252
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCACCAAAGAAAGCCAAGAAGAGGTTAGAGGGCGGAAGCTCCAACGTGTTCTCCATGTTTGAGCAGA CCCAGATCCAGGAGTTCAAGGAGGCCTTCACAATCATGGACCAGAACAGAGACGGCTTCATTGACAAGAA TGACCTAAGGGACACGTTTGCTGCCCTCGGACGAGTGAACGTGAAAAACGAAGAGATCGATGAGATGATC AAAGAGGCTCCAGGTCCAATTAACTTCACTGTGTTCCTCACCATGTTTGGGGAGAAACTTAAAGGAGCTG ACCCGGAGGAGACCATTCTCAACGCCTTCAAGGTGTTTGACCCCGAAGGCAAAGGGTCGCTGAAGGCCGA CTATGTCCGGGAGATGCTGACCACGCAAGCAGAGAGGTTCTCCAAAGAAGAGATCGACCAGATGTTCGCA GCTTTTCCCCCTGACGTCACCGGCAACCTTGATTATAAGAATTTGGTTCACATCATCACCCACGGAGAAG AGAAGGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001035252 |
Insert Size | 501 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001035252.2, NP_001030329.2 |
RefSeq Size | 677 bp |
RefSeq ORF | 501 bp |
Locus ID | 363925 |
UniProt ID | P08733 |
Gene Summary | Contractile protein that plays a role in heart development and function (By similarity). Following phosphorylation, plays a role in cross-bridge cycling kinetics and cardiac muscle contraction by increasing myosin lever arm stiffness and promoting myosin head diffusion; as a consequence of the increase in maximum contraction force and calcium sensitivity of contraction force. These events altogether slow down myosin kinetics and prolong duty cycle resulting in accumulated myosins being cooperatively recruited to actin binding sites to sustain thin filament activation as a means to fine-tune myofilament calcium sensitivity to force (PubMed:15331360). During cardiogenesis plays an early role in cardiac contractility by promoting cardiac myofibril assembly (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR202291 | Myl2 (Myc-DDK-tagged ORF) - Rat myosin, light polypeptide 2, regulatory, cardiac, slow (Myl2), (10 ug) |
CNY 3,990.00 |
|
RR202291L3 | Lenti ORF clone of Myl2 (Myc-DDK-tagged ORF) - Rat myosin, light polypeptide 2, regulatory, cardiac, slow (Myl2), (10 ug) |
CNY 6,080.00 |
|
RR202291L4 | Lenti ORF clone of Myl2 (mGFP-tagged ORF) - Rat myosin, light polypeptide 2, regulatory, cardiac, slow (Myl2), (10 ug) |
CNY 6,650.00 |