Fxyd2 (NM_145717) Rat Untagged Clone
CAT#: RN200370
Fxyd2 (untagged ORF) - Rat FXYD domain-containing ion transport regulator 2 (Fxyd2), transcript variant a, (10 ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | ATP1C; Atp1g1; GNAKATP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200370 representing NM_145717
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACAGAGCTGTCAGCTAACCATGGTGGCAGTGCCAAGGGGACGGAGAATCCCTTCGAGTATGACTATG AAACCGTCCGCAAAGGAGGCCTGATCTTCGCGGGCCTTGCCTTCGTCGTGGGACTCCTCATTCTCCTCAG CAAAAGATTCCGCTGTGGGGGCAGTAAGAAGCATAGGCAGGTCAATGAAGATGAGCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_145717 |
Insert Size | 201 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_145717.1, NP_663769.1 |
RefSeq Size | 239 bp |
RefSeq ORF | 201 bp |
Locus ID | 29639 |
UniProt ID | Q04679 |
Gene Summary | This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. This gene, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. Related gene family members have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members, with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. The Type III integral membrane protein encoded by this gene is the gamma subunit of the Na,K-ATPase present on the plasma membrane. Although the Na,K-ATPase does not depend on the gamma subunit to be functional, it is thought that the gamma subunit modulates the enzyme's activity by inducing ion channel activity. Two transcript variants have been described for this gene that encode distinct isoforms. [provided by RefSeq, Jan 2010] Transcript Variant: This variant (a) encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200370 | Fxyd2 (Myc-DDK-tagged ORF) - Rat FXYD domain-containing ion transport regulator 2 (Fxyd2), transcript variant a, (10 ug) |
CNY 3,990.00 |
|
RR200370L3 | Lenti ORF clone of Fxyd2 (Myc-DDK-tagged ORF) - Rat FXYD domain-containing ion transport regulator 2 (Fxyd2), transcript variant a, (10 ug) |
CNY 6,080.00 |
|
RR200370L4 | Lenti ORF clone of Fxyd2 (mGFP-tagged ORF) - Rat FXYD domain-containing ion transport regulator 2 (Fxyd2), transcript variant a, (10 ug) |
CNY 6,650.00 |