Oprl1 (NM_001252565) Mouse Untagged Clone

CAT#: MC227305

Oprl1 (untagged) - Mouse opioid receptor-like 1 (Oprl1), transcript variant 2



  "NM_001252565" in other vectors (1)

CNY 3,520.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms KOR-3; KOR3; LC13; LC132; mo; MOR; MOR-C; morc; NOP; O; Oprl; ORGC; ORL1; XO; XOR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227305 representing NM_001252565
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTCCCTCTTTCCTGCCCCATTCTGGGAGGTCTTGTATGGCAGCCACTTTCAAGGGAACCTGTCTC
TCCTAAATGAGACCGTACCCCATCACCTGCTCCTCAATGCTAGCCACAGTGCCTTCCTGCCCCTTGGACT
CAAGGTCACCATCGTGGGGCTCTACTTGGCTGTGTGCATCGGGGGGCTCCTGGGGAACTGCCTCGTCATG
TATGTCATCCTCAGGCACACCAAGATGAAGACTGCTACCAACATTTACATATTTAATCTGGCACTGGCTG
ATACCCTGGTCTTGCTGACACTGCCCTTCCAGGGCACAGACATCCTTCTGGGCTTCTGGCCATTTGGGAA
TGCACTGTGCAAGACGGTCATTGCTATCGACTACTACAACATGTTTACCAGCACTTTCACTTTGACTGCC
ATGAGTGTAGACCGTTATGTAGCTATCTGCCACCCTATCCGTGCCCTTGATGTTCGGACATCCAGTAAAG
CCCAGGCCGTTAATGTGGCCATATGGGCCCTGGCTTCGGTGGTTGGTGTTCCTGTTGCCATCATGGGCTC
AGCACAAGTGGAGGATGAAGAGATCGAGTGCCTGGTGGAGATCCCCGCCCCTCAGGACTATTGGGGCCCT
GTATTTGCCATCTGCATCTTCCTTTTTTCCTTCATCATCCCGGTTCTGATCATCTCTGTCTGCTACAGCC
TCATGATTCGACGACTTCGTGGTGTCCGGCTGCTTTCAGGCTCCCGAGAGAAGGACCGGAACCTGCGACG
CATCACACGGCTGGTACTGGTAGTTGTGGCTGTGTTTGTGGGCTGCTGGACACCTGTGCAGGTCTTTGTC
CTGGTTCAAGGACTGGGTGTTCAGCCAGGTAGTGAGACTGCAGTAGCCATTCTGCGCTTCTGCACAGCCC
TGGGCTATGTCAACAGTTGTCTCAATCCCATTCTCTATGCTTTCTTGGATGAGAACTTCAAGGCCTGCTT
TAGAAAGTTCTGCTGTGCTTCTGCCCTGCACCGGGAGATGCAGGTTTCTGATCGTGTGCGCAGCATTGCC
AAGGATGTAGGCCTTGGTTGCAAGACCTCTGAGACAGTACCACGGCCGGCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001252565
Insert Size 1104 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001252565.1, NP_001239494.1
RefSeq Size 2927 bp
RefSeq ORF 1104 bp
Locus ID 18389
UniProt ID P35377
Gene Summary The protein encoded by this gene is a member of the 7 transmembrane-spanning G protein-coupled receptor family, and functions as a receptor for the endogenous, opioid-related neuropeptide, nociceptin/orphanin FQ. This receptor-ligand system modulates a variety of biological functions and neurobehavior, including stress responses and anxiety behavior, learning and memory, locomotor activity, and inflammatory and immune responses. Alternatively spliced transcript variants have been described for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2017]
Transcript Variant: This variant (2) uses an alternate 5' non-coding exon; therefore, differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...