Neil1 (BC043297) Mouse Untagged Clone

CAT#: MC217894

Neil1 (untagged) - Mouse nei endonuclease VIII-like 1 (E. coli) (cDNA clone MGC:49102 IMAGE:5320651), (10ug)



  "BC043297" in other vectors (4)

CNY 6,940.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2810450N13Rik; Nei1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC043297
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAGAGGGCCCAGAGCTGCACCTGGCCAGCCACTTTGTGAATGAGACATGTAAGGGGCTGGTATTTG
GTGGGTGTGTGGAGAAGTCCTCTGTCAGCCGGAACCCGGAGGTGCCCTTTGAGAGCAGTGCCTACCACAT
CTCAGCTTTAGCCCGAGGCAAGGAGCTGCGCTTGACATTGAGCCCCCTGCCTGGGTCCCAGCCCCCTCAG
AAGCCACTGTCCCTTGTCTTCCGCTTTGGGATGTCAGGATCCTTCCAGCTGGTACCCGCAGAGGCACTGC
CCCGCCACGCCCATCTACGTTTTTACACAGCCCCACCTGCTCCCCGGCTTGCCCTTTGCTTCGTAGACAT
CCGTCGCTTTGGCCACTGGGATCCTGGGGGTGAATGGCAACCAGGCCGTGGACCCTGTGTCTTGCTGGAG
TATGAACGGTTCAGAGAGAACGTACTTCGGAACCTATCAGACAAAGCCTTTGACCGGCCCATCTGCGAGG
CCTTGTTGGACCAGAGGTTCTTCAATGGCATTGGCAACTATCTGCGGGCAGAGATCCTGTACCGGCTGAA
GATCCCTCCTTTTGAGAAGGCTCGTACAGTTCTAGAGGCCCTGCAACAGTGCCGGCCGAGCCCAGAGCTG
ACCCTGAGCCAGAAGATCAAGGCCAAACTACAGAACCCAGACCTGCTGGAACTGTGTCACTTGGTGCCCA
AGGAAGTGGTTCAGCTGGGTGAGGCCTGGGGAGGTCAAGATGGCCGGCGGCCTCTACCTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC043297
Insert Size 762 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC043297, AAH43297
RefSeq Size 1857 bp
RefSeq ORF 761 bp
Locus ID 72774
Gene Summary Involved in base excision repair of DNA damaged by oxidation or by mutagenic agents. Acts as DNA glycosylase that recognizes and removes damaged bases. Has a preference for oxidized pyrimidines, such as thymine glycol, formamidopyrimidine (Fapy) and 5-hydroxyuracil. Has marginal activity towards 8-oxoguanine. Has AP (apurinic/apyrimidinic) lyase activity and introduces nicks in the DNA strand. Cleaves the DNA backbone by beta-delta elimination to generate a single-strand break at the site of the removed base with both 3'- and 5'-phosphates. Has DNA glycosylase/lyase activity towards mismatched uracil and thymine, in particular in U:C and T:C mismatches. Specifically binds 5-hydroxymethylcytosine (5hmC), suggesting that it acts as a specific reader of 5hmC.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...