Cavin3 (NM_028444) Mouse Untagged Clone

CAT#: MC212189

Prkcdbp (untagged) - Mouse protein kinase C, delta binding protein (Prkcdbp), (10ug)



  "NM_028444" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-Prkcdbp Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 3110015B12Rik; 6330514M23Rik; SRBC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212189 representing NM_028444
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGGAGAGCGCACTGGAGCCCGGACCTGTGCCTGAGACGCCCGCAGGGGGTCCGGTGCACGCAGTCA
CCGTGGTGACCTTGCTGGAGAAATTGGCCACCATGCTGGAGGCTCTGCGGGAGCGGCAAGGCGGCCTGGC
TGAGAGGCAGGGCGGCCTGGCGGGCTCCGTGCGTCGCATACAGAGTGGCCTGGGTGCGCTGAGTCGCAGC
CACGACACCACCAGCAACACACTGACGCAGCTGCTGGCCAAGGCGGAGCGCGTGGGCTCGCACGCCGACG
CAGCCCAGGAGCGGGCCGTGCGTCGCGCTGCTCAGGTGCAGCGGTTGGAGGCCAACCACGGGCTGCTGGT
GGCGCGCGGGAAGCTGCACGTCCTGCTCTTCAAGGAGGAGACTGAAATTCCAGCCCGCGCCTTCCAGAAA
GTCCCAGAGCTCTTGGGTCCGGAGGACCAGTTGGTGCTGGGCCCAGATCAGCCAGAGGATGAAGTTGGAG
AGAGTTCTGAAGAGGAGCCAGTGGAGTCCAGGGCTCAGCGGCTGCGCCGCACTGGTTTACAGAAAGTTCA
AAGCCTGAAAAGGGCTCTTTCCAGTCGTAAAGCAGCACAGCCCACACCAGTCAAGCCGCCACGCGTAGGG
CCTGTCCGGAGCTCTGAAGGCCCATCAGAAGGCCAGCCTGCAGCTCAGCCTGAAATGGAGTCCGAGCTCG
AGACTGCCCTGGAGCCAGAACCTCCTCAACCTACCAAGGAAGATCCTGAGAAACCCGTGCTTCAAATAGA
GAGCGCAGCCTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_028444
Insert Size 783 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_028444.1, NP_082720.1
RefSeq Size 1026 bp
RefSeq ORF 783 bp
Locus ID 109042
UniProt ID Q91VJ2
Gene Summary Regulates the traffic and/or budding of caveolae (By similarity). Plays a role in caveola formation in a tissue-specific manner. Required for the formation of caveolae in smooth muscle but not in the lung and heart endothelial cells (PubMed: 28285351, PubMed:23652019). Regulates the equilibrium between cell surface-associated and cell surface-dissociated caveolae by promoting the rapid release of caveolae from the cell surface (PubMed:25588833). Plays a role in the regulation of the circadian clock. Modulates the period length and phase of circadian gene expression and also regulates expression and interaction of the core clock components PER1/2 and CRY1/2 (PubMed:23079727).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...