Lrat (NM_023624) Mouse Untagged Clone

CAT#: MC211915

Lrat (untagged) - Mouse lecithin-retinol acyltransferase (phosphatidylcholine-retinol-O-acyltransferase) (Lrat), (10ug)



  "NM_023624" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1300010A18Rik; AI449251
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211915 representing NM_023624
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGAACCCAATGCTGGAAGCTGCGTCCCTCCTCCTGGAGAAACTGCTCCTTATTTCCAACTTCAAGC
TCTTTAGCGTGAGCGTCCCGGGAGGAGGCACAGGGAAGAACCGTCCCTATGAAATCAGCTCTTTCGTCCG
GGGCGACGTGTTGGAGGTGTCACGGACCCATTTTATCCACTATGGGATCTACCTGGGGGAAAACCGTGTC
GCCCATCTAATGCCTGACATCCTGTTGGCCCTGACCAATGACAAGGAACGCACTCAGAAGGTGGTCTCCA
ACAAGCGTCTCCTCCTGGGAGTCATTTGCAAGGTGGCTAGCATCCGTGTGGACACAGTAGAGGACTTTGC
CTACGGAGCAGACATCCTAGTCAATCACCTAGACGGGACTCTCAAGAAGAAGTCCTTACTCAATGAGGAG
GTGGCACGCAGAGCTGAGCAGCAGTTGGGACTGACTCCATACAGCCTACTGTGGAACAACTGCGAACACT
TTGTGACTTACTGCAGATATGGCTCTCGGATCAGTCCACAGGCTGAGAAGTTCTATGACACCGTGAAGAT
AATCATTCGTGATCAGAGAAGCAGTCTTGCTTCGGCTGTCTTGGGATTAGCATCTATTGTCTACACAGGC
CTGGCATCATATATGACCCTTCCTGCAATCTGTATCCCATTCTGCTTGTGGATGATGTCTGGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_023624
Insert Size 696 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_023624.4, NP_076113.1
RefSeq Size 5349 bp
RefSeq ORF 696 bp
Locus ID 79235
UniProt ID Q9JI60
Gene Summary Transfers the acyl group from the sn-1 position of phosphatidylcholine to all-trans retinol, producing all-trans retinyl esters (By similarity). Retinyl esters are storage forms of vitamin A (By similarity). LRAT plays a critical role in vision (By similarity). It provides the all-trans retinyl ester substrates for the isomerohydrolase which processes the esters into 11-cis-retinol in the retinal pigment epithelium; due to a membrane-associated alcohol dehydrogenase, 11 cis-retinol is oxidized and converted into 11-cis-retinaldehyde which is the chromophore for rhodopsin and the cone photopigments (By similarity). Required for the survival of cone photoreceptors and correct rod photoreceptor cell morphology (PubMed:25416279).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...