United States
Germany
Japan
United Kingdom
China
Trem1 (NM_021406) Mouse Untagged Clone
CAT＃: MC210167
Trem1 (untagged) - Mouse triggering receptor expressed on myeloid cells 1 (Trem1), (10ug)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC210167 representing NM_021406
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_021406 |
| Insert Size | 693 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021406.4, NP_067381.1 |
| RefSeq Size | 3005 bp |
| RefSeq ORF | 693 bp |
| Locus ID | 58217 |
| UniProt ID | Q9JKE2 |
| Gene Summary | Stimulates neutrophil and monocyte-mediated inflammatory responses. Triggers release of pro-inflammatory chemokines and cytokines, as well as increased surface expression of cell activation markers. Amplifier of inflammatory responses that are triggered by bacterial and fungal infections and is a crucial mediator of septic shock (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG219079 | Trem1 (tGFP-tagged) - Mouse triggering receptor expressed on myeloid cells 1 (Trem1), (10ug) |
CNY 4,000.00 |
|
| MR219079 | Trem1 (Myc-DDK-tagged) - Mouse triggering receptor expressed on myeloid cells 1 (Trem1) |
CNY 2,400.00 |
|
| MR219079L3 | Lenti ORF clone of Trem1 (Myc-DDK-tagged) - Mouse triggering receptor expressed on myeloid cells 1 (Trem1) |
CNY 4,800.00 |
|
| MR219079L4 | Lenti ORF clone of Trem1 (mGFP-tagged) - Mouse triggering receptor expressed on myeloid cells 1 (Trem1) |
CNY 4,800.00 |
