United States
Germany
Japan
United Kingdom
China
Mapk1 (NM_011949) Mouse Untagged Clone
CAT＃: MC209720
Mapk1 (untagged) - Mouse mitogen-activated protein kinase 1 (Mapk1), transcript variant 1, (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 9030612K14Rik; AA407128; AU018647; C78273; ERK; Erk2; MAPK2; p41mapk; p42mapk; Prkm1; PRKM2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209720 representing NM_011949
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCGGCGGCGGCGGCGGGCCCGGAGATGGTCCGCGGGCAGGTGTTCGACGTAGGGCCGCGCTACA CCAACCTCTCGTACATCGGAGAAGGCGCCTACGGCATGGTTTGCTCTGCTTATGATAATCTCAACAAAGT TCGAGTTGCTATCAAGAAAATCAGTCCTTTTGAGCACCAGACCTACTGTCAAAGAACCCTAAGAGAGATA AAAATCTTACTGCGCTTCAGACATGAGAACATCATTGGCATCAATGACATCATCCGGGCACCAACCATTG AGCAAATGAAAGATGTATATATAGTACAGGACCTCATGGAGACGGACCTTTACAAGCTCTTGAAGACACA GCACCTCAGCAATGACCACATCTGCTATTTTCTTTATCAGATCCTGAGAGGGCTAAAGTATATCCATTCA GCTAACGTTCTGCACCGTGACCTCAAGCCTTCCAACCTCCTGCTGAACACCACTTGTGATCTCAAGATCT GTGACTTTGGCCTTGCCCGTGTTGCAGATCCAGATCATGATCACACAGGGTTCTTGACAGAGTACGTAGC CACACGTTGGTACAGAGCTCCAGAAATTATGTTGAATTCCAAGGGTTATACCAAGTCCATTGATATTTGG TCTGTGGGCTGCATCCTGGCAGAGATGCTATCCAACAGGCCTATCTTCCCAGGAAAGCATTACCTTGACC AGCTGAATCACATCCTGGGTATTCTTGGATCTCCATCACAGGAAGATCTGAATTGTATAATAAATTTAAA AGCTAGAAACTATTTGCTTTCTCTCCCGCACAAAAATAAGGTGCCATGGAACAGGTTGTTCCCAAATGCT GACTCCAAAGCTCTGGATTTACTGGATAAAATGTTGACATTTAACCCTCACAAGAGGATTGAAGTTGAAC AGGCTCTGGCCCACCCATACCTGGAGCAGTATTATGACCCAAGTGATGAGCCCATTGCTGAAGCGCCATT CAAGTTTGACATGGAGTTGGACGACTTACCTAAGGAGAAGCTCAAAGAACTCATTTTTGAAGAGACTGCT AGATTCCAGCCAGGATACAGATCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_011949 |
| Insert Size | 1077 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_011949.3, NP_036079.1 |
| RefSeq Size | 5099 bp |
| RefSeq ORF | 1077 bp |
| Locus ID | 26413 |
| UniProt ID | P63085 |
| Gene Summary | Serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction pathway. MAPK1/ERK2 and MAPK3/ERK1 are the 2 MAPKs which play an important role in the MAPK/ERK cascade. They participate also in a signaling cascade initiated by activated KIT and KITLG/SCF. Depending on the cellular context, the MAPK/ERK cascade mediates diverse biological functions such as cell growth, adhesion, survival and differentiation through the regulation of transcription, translation, cytoskeletal rearrangements. The MAPK/ERK cascade plays also a role in initiation and regulation of meiosis, mitosis, and postmitotic functions in differentiated cells by phosphorylating a number of transcription factors. About 160 substrates have already been discovered for ERKs. Many of these substrates are localized in the nucleus, and seem to participate in the regulation of transcription upon stimulation. However, other substrates are found in the cytosol as well as in other cellular organelles, and those are responsible for processes such as translation, mitosis and apoptosis. Moreover, the MAPK/ERK cascade is also involved in the regulation of the endosomal dynamics, including lysosome processing and endosome cycling through the perinuclear recycling compartment (PNRC); as well as in the fragmentation of the Golgi apparatus during mitosis. The substrates include transcription factors (such as ATF2, BCL6, ELK1, ERF, FOS, HSF4 or SPZ1), cytoskeletal elements (such as CANX, CTTN, GJA1, MAP2, MAPT, PXN, SORBS3 or STMN1), regulators of apoptosis (such as BAD, BTG2, CASP9, DAPK1, IER3, MCL1 or PPARG), regulators of translation (such as EIF4EBP1) and a variety of other signaling-related molecules (like ARHGEF2, DCC, FRS2 or GRB10). Protein kinases (such as RAF1, RPS6KA1/RSK1, RPS6KA3/RSK2, RPS6KA2/RSK3, RPS6KA6/RSK4, SYK, MKNK1/MNK1, MKNK2/MNK2, RPS6KA5/MSK1, RPS6KA4/MSK2, MAPKAPK3 or MAPKAPK5) and phosphatases (such as DUSP1, DUSP4, DUSP6 or DUSP16) are other substrates which enable the propagation the MAPK/ERK signal to additional cytosolic and nuclear targets, thereby extending the specificity of the cascade. Mediates phosphorylation of TPR in respons to EGF stimulation. May play a role in the spindle assembly checkpoint. Phosphorylates PML and promotes its interaction with PIN1, leading to PML degradation. Phosphorylates CDK2AP2 (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227633 | Mapk1 (tGFP-tagged) - Mouse mitogen-activated protein kinase 1 (Mapk1) transcript variant 1, (10ug) |
CNY 3,140.00 |
|
| MR227633 | Mapk1 (Myc-DDK-tagged) - Mouse mitogen-activated protein kinase 1 (Mapk1), transcript variant 1 |
CNY 3,656.00 |
|
| MR227633L3 | Lenti ORF clone of Mapk1 (Myc-DDK-tagged) - Mouse mitogen-activated protein kinase 1 (Mapk1), transcript variant 1 |
CNY 4,750.00 |
|
| MR227633L4 | Lenti ORF clone of Mapk1 (mGFP-tagged) - Mouse mitogen-activated protein kinase 1 (Mapk1), transcript variant 1 |
CNY 6,056.00 |
