Pou4f2 (NM_138944) Mouse Untagged Clone

CAT#: MC209205

Pou4f2 (untagged) - Mouse POU domain, class 4, transcription factor 2 (Pou4f2), (10ug)



  "NM_138944" in other vectors (4)

CNY 3,656.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Brn-3.2; Brn-3b; Brn3b; mBrn3-3R; Pou4f-rs1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209205 representing NM_138944
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGATGATGTCCCTGAACAGCAAGCAGGCGTTCAGCATGCCTCACGCAGGCAGCCTGCACGTGGAGC
CCAAGTACTCGGCGCTACACAGTGCCTCCCCGGGCTCCTCTGCGCCCGCGGCGCCCTCGGCCAGTTCCCC
TAGCAGCTCCAGCAACGCTGGCGGCGGCGGCGGTGGCGGCGGAGGCGGAGGCGGCGGCGGCCGGAGCAGC
AGTTCCAGCAGCAGTGGCAGCGGCGGCAGCGGCGGCGGCGGGGGCTCGGAGGCGATGCGGAGAGCTTGTC
TTCCAACCCCACCGAGCAATATATTCGGCGGGCTGGATGAGAGTCTGCTGGCCCGTGCCGAGGCTCTGGC
CGCCGTGGACATCGTCTCCCAGAGTAAGAGCCACCACCACCATCCGCCCCACCACAGCCCCTTCAAGCCG
GACGCCACTTACCACACCATGAACACCATCCCGTGCACGTCGGCAGCCTCCTCTTCTTCTGTGCCCATCT
CGCACCCGTCCGCTCTGGCTGGCACCCATCACCACCACCACCACCACCATCACCACCATCACCAGCCGCA
CCAGGCGCTGGAGGGCGAGCTGCTTGAGCACCTAAGCCCCGGGCTGGCCCTGGGAGCTATGGCGGGCCCC
GACGGCACGGTGGTGTCCACTCCGGCTCACGCACCACACATGGCCACCATGAACCCCATGCACCAAGCAG
CCCTGAGCATGGCCCACGCACATGGGCTGCCCTCGCACATGGGCTGCATGAGCGACGTGGATGCAGACCC
GCGGGACCTGGAGGCGTTCGCCGAGCGTTTCAAGCAGCGACGCATCAAGCTGGGAGTGACCCAGGCAGAT
GTGGGCTCGGCGCTGGCCAACCTCAAGATCCCGGGCGTGGGCTCGCTCAGCCAGAGCACCATCTGCAGGT
TTGAGTCTCTCACGCTGTCACACAACAACATGATCGCGCTCAAGCCCATCCTGCAGGCGTGGCTGGAGGA
AGCTGAGAAATCCCACCGCGAGAAGCTCACTAAGCCGGAGCTCTTCAATGGCGCGGAGAAGAAGCGCAAG
CGCACGTCCATCGCGGCGCCGGAGAAGCGCTCTCTGGAAGCCTACTTCGCCATCCAGCCAAGGCCCTCCT
CGGAGAAGATCGCGGCCATCGCCGAAAAGCTGGATCTCAAGAAAAATGTGGTGCGCGTCTGGTTCTGCAA
CCAGAGGCAGAAACAGAAGAGAATGAAATACTCTGCCGGCATTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_138944
Insert Size 1236 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_138944.2, NP_620394.2
RefSeq Size 3212 bp
RefSeq ORF 1236 bp
Locus ID 18997
UniProt ID Q63934
Gene Summary Tissue-specific DNA-binding transcription factor involved in the development and differentiation of target cells (PubMed:7904822, PubMed:8995448, PubMed:8972215, PubMed:10357904, PubMed:10414983, PubMed:11163266, PubMed:17668438, PubMed:25775587). Functions either as activator or repressor by modulating the rate of target gene transcription through RNA polymerase II enzyme in a promoter-dependent manner (PubMed:7904822, PubMed:7935408, PubMed:8065921, PubMed:7852360, PubMed:7797498, PubMed:8662774, PubMed:9694219, PubMed:10526314, PubMed:15733064, PubMed:17145718, PubMed:18368538). Binds to the consensus octamer motif 5'-AT[A/T]A[T/A]T[A/T]A-3' of promoter of target genes (PubMed:7904822, PubMed:8290353, PubMed:9111308, PubMed:10414983, PubMed:16152597, PubMed:17668438, PubMed:24643061). Plays a fundamental role in the gene regulatory network essential for retinal ganglion cell (RGC) differentiation (PubMed:8632990, PubMed:10357904, PubMed:25775587). Binds to an octamer site to form a ternary complex with ISL1; cooperates positively with ISL1 and ISL2 to potentiate transcriptional activation of RGC target genes being involved in RGC fate commitment in the developing retina and RGC axon formation and pathfinding (PubMed:8995448, PubMed:9261145, PubMed:8972215, PubMed:10357904, PubMed:11163266, PubMed:24643061, PubMed:25775587). Inhibits DLX1 and DLX2 transcriptional activities preventing DLX1- and DLX2-mediated ability to promote amacrine cell fate specification (PubMed:21875655). In cooperation with TP53 potentiates transcriptional activation of BAX promoter activity increasing neuronal cell apoptosis (PubMed:17145718). Negatively regulates BAX promoter activity in the absence of TP53 (PubMed:17145718). Acts as a transcriptional coactivator via its interaction with the transcription factor ESR1 by enhancing its effect on estrogen response element (ERE)-containing promoter (PubMed:9448000). Antagonizes the transcriptional stimulatory activity of POU4F1 by preventing its binding to an octamer motif (PubMed:7935408, PubMed:8065921, PubMed:8537352, PubMed:7852360, PubMed:8662774). Involved in TNFSF11-mediated terminal osteoclast differentiation (PubMed:17668438).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...