Pou4f2 (NM_138944) Mouse Tagged ORF Clone
CAT#: MR223071
- TrueORF®
Pou4f2 (Myc-DDK-tagged) - Mouse POU domain, class 4, transcription factor 2 (Pou4f2)
ORF Plasmid: tGFP
"NM_138944" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 2,850.00
Cited in 2 publications. |
CNY 300.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | Brn-3.2; Brn-3b; Brn3b; mBrn3-3R; Pou4f-rs1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR223071 representing NM_138944
Red=Cloning site Blue=ORF Green=Tags(s) CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGATGATGTCCCTGAACAGCAAGCAGGCGTTCAGCATGCCTCACGCAGGCAGCCTGCACGTGGAGC CCAAGTACTCGGCGCTACACAGTGCCTCCCCGGGCTCCTCTGCGCCCGCGGCGCCCTCGGCCAGTTCCCC TAGCAGCTCCAGCAACGCTGGCGGCGGCGGCGGTGGCGGCGGAGGCGGAGGCGGCGGCGGCCGGAGCAGC AGTTCCAGCAGCAGTGGCAGCGGCGGCAGCGGCGGCGGCGGGGGCTCGGAGGCGATGCGGAGAGCTTGTC TTCCAACCCCACCGAGCAATATATTCGGCGGGCTGGATGAGAGTCTGCTGGCCCGTGCCGAGGCTCTGGC CGCCGTGGACATCGTCTCCCAGAGTAAGAGCCACCACCACCATCCGCCCCACCACAGCCCCTTCAAGCCG GACGCCACTTACCACACCATGAACACCATCCCGTGCACGTCGGCAGCCTCCTCTTCTTCTGTGCCCATCT CGCACCCGTCCGCTCTGGCTGGCACCCATCACCACCACCACCACCACCATCACCACCATCACCAGCCGCA CCAGGCGCTGGAGGGCGAGCTGCTTGAGCACCTAAGCCCCGGGCTGGCCCTGGGAGCTATGGCGGGCCCC GACGGCACGGTGGTGTCCACTCCGGCTCACGCACCACACATGGCCACCATGAACCCCATGCACCAAGCAG CCCTGAGCATGGCCCACGCACATGGGCTGCCCTCGCACATGGGCTGCATGAGCGACGTGGATGCAGACCC GCGGGACCTGGAGGCGTTCGCCGAGCGTTTCAAGCAGCGACGCATCAAGCTGGGAGTGACCCAGGCAGAT GTGGGCTCGGCGCTGGCCAACCTCAAGATCCCGGGCGTGGGCTCGCTCAGCCAGAGCACCATCTGCAGGT TTGAGTCTCTCACGCTGTCACACAACAACATGATCGCGCTCAAGCCCATCCTGCAGGCGTGGCTGGAGGA AGCTGAGAAATCCCACCGCGAGAAGCTCACTAAGCCGGAGCTCTTCAATGGCGCGGAGAAGAAGCGCAAG CGCACGTCCATCGCGGCGCCGGAGAAGCGCTCTCTGGAAGCCTACTTCGCCATCCAGCCAAGGCCCTCCT CGGAGAAGATCGCGGCCATCGCCGAAAAGCTGGATCTCAAGAAAAATGTGGTGCGCGTCTGGTTCTGCAA CCAGAGGCAGAAACAGAAGAGAATGAAATACTCTGCCGGCATT ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | NM_138944 |
ORF Size | 1233 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_138944.3 |
RefSeq Size | 3212 bp |
RefSeq ORF | 1236 bp |
Locus ID | 18997 |
UniProt ID | Q63934 |
MW | 43.6 kDa |
Gene Summary | Tissue-specific DNA-binding transcription factor involved in the development and differentiation of target cells (PubMed:7904822, PubMed:8995448, PubMed:8972215, PubMed:10357904, PubMed:10414983, PubMed:11163266, PubMed:17668438, PubMed:25775587). Functions either as activator or repressor by modulating the rate of target gene transcription through RNA polymerase II enzyme in a promoter-dependent manner (PubMed:7904822, PubMed:7935408, PubMed:8065921, PubMed:7852360, PubMed:7797498, PubMed:8662774, PubMed:9694219, PubMed:10526314, PubMed:15733064, PubMed:17145718, PubMed:18368538). Binds to the consensus octamer motif 5'-AT[A/T]A[T/A]T[A/T]A-3' of promoter of target genes (PubMed:7904822, PubMed:8290353, PubMed:9111308, PubMed:10414983, PubMed:16152597, PubMed:17668438, PubMed:24643061). Plays a fundamental role in the gene regulatory network essential for retinal ganglion cell (RGC) differentiation (PubMed:8632990, PubMed:10357904, PubMed:25775587). Binds to an octamer site to form a ternary complex with ISL1; cooperates positively with ISL1 and ISL2 to potentiate transcriptional activation of RGC target genes being involved in RGC fate commitment in the developing retina and RGC axon formation and pathfinding (PubMed:8995448, PubMed:9261145, PubMed:8972215, PubMed:10357904, PubMed:11163266, PubMed:24643061, PubMed:25775587). Inhibits DLX1 and DLX2 transcriptional activities preventing DLX1- and DLX2-mediated ability to promote amacrine cell fate specification (PubMed:21875655). In cooperation with TP53 potentiates transcriptional activation of BAX promoter activity increasing neuronal cell apoptosis (PubMed:17145718). Negatively regulates BAX promoter activity in the absence of TP53 (PubMed:17145718). Acts as a transcriptional coactivator via its interaction with the transcription factor ESR1 by enhancing its effect on estrogen response element (ERE)-containing promoter (PubMed:9448000). Antagonizes the transcriptional stimulatory activity of POU4F1 by preventing its binding to an octamer motif (PubMed:7935408, PubMed:8065921, PubMed:8537352, PubMed:7852360, PubMed:8662774). Involved in TNFSF11-mediated terminal osteoclast differentiation (PubMed:17668438).[UniProtKB/Swiss-Prot Function] |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Bcl-2, Bcl-xL, and p-AKT are involved in neuroprotective effects of transcription factor Brn3b in an ocular hypertension rat model of glaucoma
,Phatak, NR;Stankowska, DL;Krishnamoorthy, RR;,
Mol. Vis.
,PubMed ID 27587945
[Pou4f2]
|
Neuroprotective effects of transcription factor Brn3b in an ocular hypertension rat model of glaucoma
,Stankowska, DL;Minton, AZ;Rutledge, MD;Mueller, BH;Phatak, NR;He, S;Ma, HY;Forster, MJ;Yorio, T;Krishnamoorthy, RR;,
Invest. Ophthalmol. Vis. Sci.
,PubMed ID 25587060
[POU4F2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC209205 | Pou4f2 (untagged) - Mouse POU domain, class 4, transcription factor 2 (Pou4f2), (10ug) |
CNY 3,656.00 |
|
MG223071 | Pou4f2 (tGFP-tagged) - Mouse POU domain class 4 transcription factor 2 (Pou4f2), (10ug) |
CNY 3,140.00 |
|
MR223071L3 | Lenti ORF clone of Pou4f2 (Myc-DDK-tagged) - Mouse POU domain, class 4, transcription factor 2 (Pou4f2) |
CNY 4,750.00 |
|
MR223071L4 | Lenti ORF clone of Pou4f2 (mGFP-tagged) - Mouse POU domain, class 4, transcription factor 2 (Pou4f2) |
CNY 4,750.00 |