Myl1 (NM_021285) Mouse Untagged Clone

CAT#: MC209004

Myl1 (untagged) - Mouse myosin, light polypeptide 1 (Myl1), transcript variant 1f, (10ug)



  "NM_021285" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI325107; D12Mgi4; MLC1; MLC1f; MLC3; MLC3f; Myl; Mylf
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209004 representing NM_021285
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCACCAAAGAAAGACGTGAAGAAGCCCGCTGCTGCGCCTGCCCCAGCCCCGGCCCCGGCCCCTGCCC
CAGCCAAACCTAAGGAAGAAAAAATCGATCTGTCTGCTATTAAGATCGAGTTCTCTAAGGAGCAACAGGA
GGACTTCAAGGAGGCATTTCTCCTGTTTGACAGAACAGGTGAATGCAAGATCACCTTAAGTCAGGTGGGA
GACGTCCTCCGGGCTCTGGGCACCAATCCCACCAATGCAGAGGTCAAGAAGGTTCTTGGGAACCCCAGCA
ATGAAGAGATGAATGCTAAGAAAATCGAGTTTGAACAGTTTCTGCCCATGATGCAAGCTATCTCCAACAA
CAAGGACCAGGGAGGTTATGAAGATTTCGTTGAGGGTCTGCGTGTCTTCGACAAGGAGGGCAATGGCACC
GTCATGGGTGCTGAACTCCGCCATGTCCTCGCCACTCTGGGAGAGAAGATGAAGGAGGAAGAGGTAGAAG
CGTTGCTGGCAGGCCAGGAGGACTCCAATGGCTGCATCAACTATGAAGCTTTTGTCAAACACATCATGTC
TGTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_021285
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021285.3, NP_067260.1
RefSeq Size 1003 bp
RefSeq ORF 567 bp
Locus ID 17901
UniProt ID P05977
Gene Summary Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two non-phosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in fast skeletal muscle. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1f) encodes a protein that is 38 aa longer than isoform 3f. Transcript variants 1f and 3f differ in their first two exons.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...