Csrp3 (NM_013808) Mouse Untagged Clone

CAT#: MC208348

Csrp3 (untagged) - Mouse cysteine and glycine-rich protein 3 (Csrp3), transcript variant 1, (10ug)



  "NM_013808" in other vectors (6)

CN¥ 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms CRP3; MLP; MMLP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208348 representing NM_013808
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAAACTGGGGTGGAGGTGCAAAATGTGGAGCCTGTGAAAAGACGGTCTACCATGCAGAAGAAATCC
AGTGCAATGGGAGGAGTTTCCACAAGACCTGTTTCCACTGCATGGCCTGCAGGAAAGCTCTGGACAGCAC
CACAGTGGCAGCTCATGAGTCAGAGATCTACTGTAAGGTGTGCTATGGGCGCAGGTATGGCCCCAAGGGG
ATCGGGTTCGGACAAGGCGCTGGCTGCCTCAGCACAGACACTGGCGAGCATCTTGGCCTGCAGTTCCAAC
AATCCCCAAAGCCAGCTCGAGCAGCCACCACAAGCAACCCTTCCAAATTCTCTGCAAAGTTTGGAGAATC
AGAGAAGTGCCCACGATGTGGAAAGTCGGTATACGCTGCTGAGAAGGTCATGGGAGGTGGCAAGCCCTGG
CACAAGACCTGCTTCCGCTGTGCCATCTGTGGGAAGAGCCTGGAGTCTACAAATGTCACTGACAAGGATG
GGGAGCTCTACTGCAAAGTTTGCTATGCCAAAAATTTTGGCCCCACAGGCATTGGGTTTGGAGGGCTTAC
ACAGCAAGTGGAAAAGAAGGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013808
Insert Size 585 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013808.4, NP_038836.1
RefSeq Size 1057 bp
RefSeq ORF 585 bp
Locus ID 13009
UniProt ID P50462
Gene Summary Positive regulator of myogenesis. Acts as cofactor for myogenic bHLH transcription factors such as MYOD1, and probably MYOG and MYF6. Enhances the DNA-binding activity of the MYOD1:TCF3 isoform E47 complex and may promote formation of a functional MYOD1:TCF3 isoform E47:MEF2A complex involved in myogenesis (By similarity). Plays a crucial and specific role in the organization of cytosolic structures in cardiomyocytes. Could play a role in mechanical stretch sensing. May be a scaffold protein that promotes the assembly of interacting proteins at Z-line structures. It is essential for calcineurin anchorage to the Z line. Required for stress-induced calcineurin-NFAT activation (PubMed:9039266, PubMed:15665106). The role in regulation of cytoskeleton dynamics by association with CFL2 is reported conflictingly. Proposed to contribute to the maintenance of muscle cell integerity through an actin-based mechanism. Can directly bind to actin filaments, cross-link actin filaments into bundles without polarity selectivity and protect them from dilution- and cofilin-mediated depolymerization; the function seems to involve its self-association (By similarity). In vitro can inhibit PKC/PRKCA activity. Proposed to be involved in cardiac stress signaling by down-regulating excessive PKC/PRKCA signaling (PubMed:27353086).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...