Wdr83os (NM_001001493) Mouse Untagged Clone

CAT#: MC207977

BC056474 (untagged) - Mouse cDNA sequence BC056474 (BC056474), (10ug)



  "NM_001001493" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Wdr83os
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207977 representing NM_001001493
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCACTAACAATATGTCCGACCCACGAAGGCCCAACAAAGTGCTGAGGTATAAGCCTCCCCCGAGTG
AGTGCAACCCGGCTTTAGACGACCCGACTCCGGACTACATGAATCTTCTTGGCATGATCTTCAGCATGTG
TGGCCTCATGCTTAAGCTGAAGTGGTGTGCTTGGGTTGCTGTCTACTGCTCCTTTATCAGCTTTGCCAAC
TCGCGGAGCTCGGAGGACACTAAGCAGATGATGAGTAGCTTCATGCTCTCTATCTCCGCCGTGGTGATGT
CCTATCTGCAGAATCCTCAGCCCATGACGCCTCCCTGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001001493
Insert Size 321 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001001493.2, NP_001001493.1
RefSeq Size 815 bp
RefSeq ORF 321 bp
Locus ID 414077
UniProt ID Q6ZWX0
Gene Summary Component of the PAT complex, an endoplasmic reticulum (ER)-resident membrane multiprotein complex that facilitates multi-pass membrane proteins insertion into membranes. The PAT complex acts as an intramembrane chaperone by directly interacting with nascent transmembrane domains (TMDs), releasing its substrates upon correct folding, and is needed for optimal biogenesis of multi-pass membrane proteins. WDR83OS/Asterix is the substrate-interacting subunit of the PAT complex, whereas CCDC47 is required to maintain the stability of WDR83OS/Asterix. WDR83OS/Asterix associates with the first transmembrane domain (TMD1) of the nascent chain, independently of the N-glycosylation of the chain and irrespective of the amino acid sequence and transmembrane topology of TMD1. The PAT complex favors the binding to TMDs with exposed hydrophilic amino acids within the lipid bilayer and provides a membrane-embedded partially hydrophilic environment in which TMD1 binds.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...