Rhod (NM_007485) Mouse Untagged Clone
CAT#: MC203609
Rhod (untagged) - Mouse ras homolog gene family, member D (Rhod), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI326383; Arhd; Rho; RhoHP1; RhoM |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC047989
CGCCGGGCCAGCCCCGCGCCCGCCGCAGCCAGCCCGCCGCGTACCGCCTGCTGCTCCGCGCACCGCCGTC CGCCAGCCAGGGATGAACGCGTCCCAGGTTGCGGGAGAAGAGGCGCCGCAGAGCGGGCACTCGGTCAAGG TGGTCCTGGTGGGCGACGGGGGCTGCGGGAAGACGTCACTGATGATGGTCTTCGCCAAAGGGGCCTTCCC AGAGAGCTACAGTCCCACAGTGTTTGAGCGCTATAATGCCACTCTGCAGATGAAGGGTAAACCTGTGCAC CTCCAAATCTGGGACACAGCCGGGCAAGATGACTATGACCGCCTCCGGCCCTTGTTCTATCCTGATGCCA ATGTCTTGCTCCTCTGCTTCGATGTGACCAATCCAAACAGCTTTGACAACGTCTCCAACCGGTGGTACCC AGAGGTGACACATTTCTGCAAGGGAGTGCCCATCATTGTTGTGGGCTGCAAGATAGACCTGCGTAAGGAC AAGGTGCTGGTGAACAACCTGCGGAAGAAAAGACTGGAGCCCGTGACCTACCACAGGGGCCACGATATGG CAAGGTCTGTGGGAGCGGTGGCCTATCTTGAGTGTTCAGCTCGGCTCCATGACAACGTGGAAGCCGTCTT CCAGGAAGCAGCAGAAGTGGCTCTCAGCAGTCGCAGACATAACTTTTGGCGGCGGATTACTCAGAATTGT TGCTTGGCCACCTGACTGGCTTGGAACCCACCTTGCCTTCCGGTTTACTCCGCTGCAGAAAGACCCAGAA GCAGAACTTGTACTCTGTTGACTGGGATGGACCTAATCCCTAGGCTGAGCTGGTAGAACCACACATCCAT CCACAGATGGGCTCCAATGAGGCCTGGCCCCTGGACCGAGGAATCCTGGATTGAGGAAGAGGGTTCCCAG ACCCTTAGCTCTGGAACCATTATAGACTCCTGTGCCCAATCCTGGACCTGCGTCCTGAGCGGGGTCTGTG CGGTCTGTTTGGCGCCACCTTGTGGCTATTCTATTGAGTTATATCTACAGGACCTAGGGTTCCCAAGACC ATCTTGCCCGGGCTAATACCCTGCCCCGTCCGTGATCATCCTATTTATCCCATTGCTAAGTGTAACAACT AAAATGGCAGCACTTGCAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_007485 |
Insert Size | 633 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC047989, AAH47989 |
RefSeq Size | 1153 bp |
RefSeq ORF | 633 bp |
Locus ID | 11854 |
UniProt ID | P97348 |
Gene Summary | Involved in endosome dynamics. May coordinate membrane transport with the function of the cytoskeleton. Involved in the internalization and trafficking of activated tyrosine kinase receptors such as PDGFRB. Participates in the reorganization of actin cytoskeleton; the function seems to involve WHAMM and includes regulation of filopodia formation and actin filament bundling. Can modulate the effect of DAPK3 in reorganization of actin cytoskeleton and focal adhesion dissolution.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202278 | Rhod (tGFP-tagged) - Mouse ras homolog gene family, member D (Rhod) |
CNY 2,850.00 |
|
MR202278 | Rhod (Myc-DDK-tagged) - Mouse ras homolog gene family, member D (Rhod) |
CNY 2,400.00 |
|
MR202278L3 | Lenti ORF clone of Rhod (Myc-DDK-tagged) - Mouse ras homolog gene family, member D (Rhod) |
CNY 4,750.00 |
|
MR202278L4 | Lenti ORF clone of Rhod (mGFP-tagged) - Mouse ras homolog gene family, member D (Rhod) |
CNY 4,750.00 |