Asph Mouse qPCR Primer Pair (NM_023066)

CAT#: MP200973

qSTAR qPCR primer pairs against Mus musculus gene Asph



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (14)
Asph (Myc-DDK-tagged) - Mouse aspartate-beta-hydroxylase (Asph), transcript variant 1
    • 10 ug

CNY 5,432.00
CNY 6,460.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2,710.00


Asph (Myc-DDK-tagged) - Mouse aspartate-beta-hydroxylase (Asph), transcript variant 8
    • 10 ug

CNY 2,470.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


Asph (Myc-DDK-tagged) - Mouse aspartate-beta-hydroxylase (Asph), transcript variant 3
    • 10 ug

CNY 7,220.00


Asph (Myc-DDK-tagged) - Mouse aspartate-beta-hydroxylase (Asph), transcript variant 7
    • 10 ug

CNY 2,570.00


Asph (Myc-DDK-tagged) - Mouse aspartate-beta-hydroxylase (Asph), transcript variant 5
    • 10 ug

CNY 2,950.00


Asph (myc-DDK-tagged) - Mouse aspartate-beta-hydroxylase (Asph), transcript variant 11
    • 10 ug

CNY 6,560.00


Asph (Myc-DDK-tagged) - Mouse aspartate-beta-hydroxylase (Asph), transcript variant 10
    • 10 ug

CNY 2,090.00


Asph (Myc-DDK-tagged) - Mouse aspartate-beta-hydroxylase (Asph), transcript variant 6
    • 10 ug

CNY 2,760.00


Asph (Myc-DDK-tagged) - Mouse aspartate-beta-hydroxylase (Asph), transcript variant 9
    • 10 ug

CNY 2,190.00


Asph (Myc-DDK-tagged) - Mouse aspartate-beta-hydroxylase (Asph), transcript variant 4
    • 10 ug

CNY 3,140.00


Asph (Myc-DDK-tagged) - Mouse aspartate-beta-hydroxylase (Asph), transcript variant 2
    • 10 ug

CNY 2,640.00

Specifications

Product Data
Gene ID 65973
Forward Sequence AACGACCTTGGCGTAGGATACC
Reverse Sequence GTTCTGTGCCTTCAGGATGAAGC
Synonyms 2310005F16Rik; 3110001L23Rik; AI848629; AW261690; AW561901; BAH; C79816; cI-37
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...