RBMS3 Human qPCR Primer Pair (NM_001003793)

CAT#: HP233971

qSTAR qPCR primer pairs against Homo sapiens gene RBMS3



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (10)
Lenti ORF particles, RBMS3 (Myc-DDK tagged) - Human RNA binding motif, single stranded interacting protein 3 (RBMS3), transcript variant 1, 200ul, >10^7 TU/mL
    • 200 ul

CNY 8,835.00


RBMS3 mouse monoclonal antibody,clone OTI8A9
    • 100 ul

CNY 1,999.00
CNY 2,700.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2,710.00


RBMS3 (Myc-DDK-tagged)-Human RNA binding motif, single stranded interacting protein 3 (RBMS3), transcript variant 1
    • 10 ug

CNY 3,656.00
CNY 3,990.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


RBMS3 (Myc-DDK-tagged)-Human RNA binding motif, single stranded interacting protein 3 (RBMS3), transcript variant 5
    • 10 ug

CNY 3,656.00
CNY 3,990.00


RBMS3 (Myc-DDK-tagged)-Human RNA binding motif, single stranded interacting protein 3 (RBMS3), transcript variant 2
    • 10 ug

CNY 3,656.00
CNY 3,990.00


RBMS3 (Myc-DDK-tagged)-Human RNA binding motif, single stranded interacting protein 3 (RBMS3), transcript variant 4
    • 10 ug

CNY 3,990.00


RBMS3 (Myc-DDK-tagged)-Human RNA binding motif, single stranded interacting protein 3 (RBMS3), transcript variant 3
    • 10 ug

CNY 3,656.00
CNY 3,990.00

Specifications

Product Data
Gene ID 27303
Forward Sequence GTGTTGGCTTTGCCAGAATGGAG
Reverse Sequence CGCTTCTTTTGTCCTCCATCAGC
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...