SSX2IP Human qPCR Primer Pair (NM_014021)

CAT#: HP210587

qSTAR qPCR primer pairs against Homo sapiens gene SSX2IP



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (9)
SSX2IP mouse monoclonal antibody, clone OTI5C3 (formerly 5C3)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


SSX2IP (Myc-DDK-tagged)-Human synovial sarcoma, X breakpoint 2 interacting protein (SSX2IP), transcript variant 5
    • 10 ug

CNY 4,576.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2,710.00


SSX2IP (Myc-DDK-tagged)-Human synovial sarcoma, X breakpoint 2 interacting protein (SSX2IP), transcript variant 4
    • 10 ug

CNY 4,560.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


SSX2IP (Myc-DDK-tagged)-Human synovial sarcoma, X breakpoint 2 interacting protein (SSX2IP), transcript variant 1
    • 10 ug

CNY 4,560.00


SSX2IP (Myc-DDK-tagged)-Human synovial sarcoma, X breakpoint 2 interacting protein (SSX2IP), transcript variant 3
    • 10 ug

CNY 4,560.00


SSX2IP (Myc-DDK-tagged)-Human synovial sarcoma, X breakpoint 2 interacting protein (SSX2IP), transcript variant 2
    • 10 ug

CNY 4,560.00

Specifications

Product Data
Gene ID 117178
Forward Sequence GACTTTTGCCAGACACGTTCCTG
Reverse Sequence AGGTCTTGACGCCACACTCCAT
Synonyms ADIP; hMsd1
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...