Neuroglycan C (CSPG5) Human qPCR Primer Pair (NM_006574)

CAT#: HP209496

qSTAR qPCR primer pairs against Homo sapiens gene CSPG5



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (9)
Rabbit polyclonal anti-CSPG5 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


CSPG5 (Myc-DDK-tagged)-Human chondroitin sulfate proteoglycan 5 (neuroglycan C) (CSPG5), transcript variant 1
    • 10 ug

CNY 4,016.00
CNY 4,560.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2,710.00


CSPG5 (Myc-DDK tagged) - Homo sapiens chondroitin sulfate proteoglycan 5 (neuroglycan C) (CSPG5), transcript variant 5
    • 10 ug

CNY 3,990.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


CSPG5 (Myc-DDK tagged) - Homo sapiens chondroitin sulfate proteoglycan 5 (neuroglycan C) (CSPG5), transcript variant 4
    • 10 ug

CNY 3,990.00


CSPG5 (Myc-DDK tagged) - Homo sapiens chondroitin sulfate proteoglycan 5 (neuroglycan C) (CSPG5), transcript variant 2
    • 10 ug

CNY 3,990.00


CSPG5 (Myc-DDK tagged) - Homo sapiens chondroitin sulfate proteoglycan 5 (neuroglycan C) (CSPG5), transcript variant 3
    • 10 ug

CNY 4,560.00

Specifications

Product Data
Gene ID 10675
Forward Sequence CAGTGGCTTTGTGCGGCATAAC
Reverse Sequence CTTGTGCCAGATGTAGTCCTGC
Synonyms NGC
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...