Caspase 5 (CASP5) Human qPCR Primer Pair (NM_004347)

CAT#: HP207675

qSTAR qPCR primer pairs against Homo sapiens gene CASP5



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Cited in 1 publication.

Product images

经常一起买 (8)
CASP5 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00


CASP5 (Myc-DDK-tagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant a
    • 10 ug

CNY 3,656.00
CNY 3,990.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


CASP5 (Myc-DDK-tagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant a
    • 10 ug

CNY 3,656.00
CNY 3,990.00


CASP5 (Myc-DDK-tagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant b
    • 10 ug

CNY 3,656.00
CNY 3,990.00


CASP5 (Myc-DDK-tagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant c
    • 10 ug

CNY 2,400.00
CNY 3,990.00


CASP5 (Myc-DDK-tagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant f
    • 10 ug

CNY 3,656.00
CNY 3,990.00

Specifications

Product Data
Gene ID 838
Forward Sequence ACAACCGCAACTGCCTCAGTCT
Reverse Sequence GAATCTGCCTCCAGGTTCTCAG
Synonyms ICE(rel)III; ICEREL-III; ICH-3
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...