ROBO2 Human qPCR Primer Pair (NM_002942)

CAT#: HP206551

qSTAR qPCR primer pairs against Homo sapiens gene ROBO2



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (9)
ROBO2 Antibody - N-terminal region
    • 50 ug

CNY 5,070.00


ROBO2 (Myc-DDK-tagged)-Human roundabout, axon guidance receptor, homolog 2 (Drosophila) (ROBO2), transcript variant 1
    • 10 ug

CNY 9,536.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2,710.00


ROBO2 (Myc-DDK-tagged)-Human roundabout, axon guidance receptor, homolog 2 (Drosophila) (ROBO2), transcript variant 2
    • 10 ug

CNY 13,780.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


ROBO2 (myc-DDK-tagged) - Human roundabout, axon guidance receptor, homolog 2 (Drosophila) (ROBO2), transcript variant 3
    • 10 ug

CNY 13,780.00


ROBO2 (myc-DDK-tagged) - Human roundabout, axon guidance receptor, homolog 2 (Drosophila) (ROBO2), transcript variant 4
    • 10 ug

CNY 14,440.00


ROBO2 (myc-DDK-tagged) - Human roundabout, axon guidance receptor, homolog 2 (Drosophila) (ROBO2), transcript variant 5
    • 10 ug

CNY 5,800.00

Specifications

Product Data
Gene ID 6092
Forward Sequence AAGGAGTGGACCACAGGCAAGT
Reverse Sequence CTCGGTAGCCTTGGATAAACTGG
Synonyms SAX3
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...