c-Myc (MYC) Human qPCR Primer Pair (NM_002467)
CNY 1,140.00
Cited in 3 publications. |
Product images
CNY 5,488.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Gene ID | 4609 |
Forward Sequence | CCTGGTGCTCCATGAGGAGAC |
Reverse Sequence | CAGACTCTGACCTTTTGCCAGG |
Synonyms | bHLHe39; c-Myc; MRTL; MYCC |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
Long Noncoding RNA KCNQ1OT1 Confers Gliomas Resistance to Temozolomide and Enhances Cell Growth by Retrieving PIM1 From miR-761
,Wang, W;Han, S;Gao, W;Feng, Y;Li, K;Wu, D;,
Cell. Mol. Neurobiol.
,PubMed ID 32897512
[MYC]
|
HDAC6 plays a non-canonical role in the regulation of anti-tumor immune responses, dissemination, and invasiveness of breast cancer
,Banik, D;Noonepalle, S;Hadley, M;Palmer, E;Gracia-Hernandez, M;Zevallos-Delgado, C;Manhas, N;Simonyan, H;Young, CN;Popratiloff, A;Chiappinelli, KB;Fernandes, R;Sotomayor, EM;Villagra, A;,
Cancer Res.
,PubMed ID 32605998
[MYC]
|
Anti-proliferative effects of ?-tocotrienol are associated with suppression of c-Myc expression in mammary tumour cells
,Parajuli, P;Tiwari, RV;Sylvester, PW;,
Cell Prolif.
,PubMed ID 26096843
[MYC]
|
Documents
FAQs |
Resources
基因表达相关资源 |