UGT1A6 Human qPCR Primer Pair (NM_001072)

Specifications

Product Data
Gene ID	54578
Forward Sequence	GCAAAGCGCATGGAGACTAAGG
Reverse Sequence	GGTCCTTGTGAAGGCTGGAGAG
Synonyms	GNT1; HLUGP; HLUGP1; hUG-BR1; UDPGT; UDPGT 1-6; UGT-1A; UGT-1C; UGT-1E; UGT-1F; UGT1; UGT1-01; UGT1-03; UGT1-05; UGT1-06; UGT1.1; UGT1.3; UGT1.5; UGT1.6; UGT1A; UGT1A1; UGT1A3; UGT1A5; UGT1A6S; UGT1C; UGT1E; UGT1F
Quality Control	The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability	Store at -20°C.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.