CHRM2 Human qPCR Primer Pair (NM_000739)

CAT#: HP200685

qSTAR qPCR primer pairs against Homo sapiens gene CHRM2



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (12)
Rabbit polyclonal anti-CHRM2 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


CHRM2 (Myc-DDK-tagged)-Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 4
    • 10 ug

CNY 3,656.00
CNY 3,990.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2,710.00


CHRM2 (Myc-DDK-tagged)-Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 5
    • 10 ug

CNY 3,656.00
CNY 3,990.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


CHRM2 (Myc-DDK-tagged)-Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 3
    • 10 ug

CNY 3,656.00
CNY 3,990.00


CHRM2 (Myc-DDK-tagged)-Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 2
    • 10 ug

CNY 3,656.00
CNY 3,990.00


CHRM2 (Myc-DDK-tagged)-Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 8
    • 10 ug

CNY 3,656.00
CNY 3,990.00


CHRM2 (Myc-DDK-tagged)-Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 6
    • 10 ug

CNY 3,656.00
CNY 3,990.00


CHRM2 (Myc-DDK-tagged)-Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 1
    • 10 ug

CNY 3,656.00
CNY 3,990.00


CHRM2 (Myc-DDK-tagged)-Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 7
    • 10 ug

CNY 3,656.00
CNY 3,990.00

Specifications

Product Data
Gene ID 1129
Forward Sequence TGCTGTCACCTTTGGTACGGCT
Reverse Sequence TGGTTGGCAACAGGCTCCTTCT
Synonyms HM2
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...