Trpc6 Mouse Gene Knockout Kit (CRISPR)
CAT#: KN318295
Trpc6 - mouse gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12,260.00
CNY 3,710.00
CNY 10,216.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | Trpc6 |
Locus ID | 22068 |
Kit Components |
KN318295G1, Trpc6 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AGTCCTGGCTCTCGTTGCGC KN318295G2, Trpc6 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCCCGAGGTTCGTGACCCGG KN318295-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001282086, NM_001282087, NM_013838 |
Synonyms | AV025995; LLHWJM002; LLHWJM003; LLHWJM004; mtrp6; TRP-6; Trrp6 |
Summary | Thought to form a receptor-activated non-selective calcium permeant cation channel. Probably is operated by a phosphatidylinositol second messenger system activated by receptor tyrosine kinases or G-protein coupled receptors. Activated by diacylglycerol (DAG) in a membrane-delimited fashion, independently of protein kinase C. Seems not to be activated by intracellular calcium store depletion.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN318295BN | Trpc6 - mouse gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN318295LP | Trpc6 - mouse gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN318295RB | Trpc6 - mouse gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN518295 | Trpc6 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |
|
GA204457 | Trpc6 CRISPRa kit - CRISPR gene activation of mouse transient receptor potential cation channel, subfamily C, member 6 |
CNY 12,255.00 |