Frs2 Mouse Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA	GFP-puro
Symbol	Frs2
Locus ID	327826
Kit Components	KN306139G1, Frs2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: ACACTGTCCCAGATAACCAT KN306139G2, Frs2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGACCTTAAACTTGTTCCGA KN306139-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_177798
Synonyms	4732458E18; C330018A15Rik; Frs2alpha; SNT1
Summary	Adapter protein that links activated FGR and NGF receptors to downstream signaling pathways. Plays an important role in the activation of MAP kinases and in the phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, in response to ligand-mediated activation of FGFR1. Modulates signaling via SHC1 by competing for a common binding site on NTRK1.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.