Foxo3 Mouse Gene Knockout Kit (CRISPR)
CAT#: KN306098
Foxo3 - mouse gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12,260.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | Foxo3 |
Locus ID | 56484 |
Kit Components |
KN306098G1, Foxo3 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCCGCTCTCTCCGCTCGAAG KN306098G2, Foxo3 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GTCGGCCACGCTCCTGTACG KN306098-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_019740 |
Synonyms | 1110048B16Rik; 2010203A17Rik; C76856; Fkhr2; FKHRL1; Foxo3a |
Summary | Transcriptional activator that recognizes and binds to the DNA sequence 5'-[AG]TAAA[TC]A-3' and regulates different processes, such as apoptosis and autophagy (PubMed:18054316, PubMed:18054315, PubMed:23805378). Acts as a positive regulator of autophagy in skeletal muscle: in starved cells, enters the nucleus following dephosphorylation and binds the promoters of autophagy genes, such as GABARAP1L, MAP1LC3B and ATG12, thereby activating their expression, resulting in proteolysis of skeletal muscle proteins (PubMed:18054316, PubMed:18054315, PubMed:25402684). Triggers apoptosis in the absence of survival factors, including neuronal cell death upon oxidative stress (By similarity). Participates in post-transcriptional regulation of MYC: following phosphorylation by MAPKAPK5, promotes induction of miR-34b and miR-34c expression, 2 post-transcriptional regulators of MYC that bind to the 3' UTR of MYC transcript and prevent its translation (By similarity). In response to metabolic stress, translocates into the mitochondria where it promotes mtDNA transcription (PubMed:23283301).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN306098BN | Foxo3 - mouse gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN306098LP | Foxo3 - mouse gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN306098RB | Foxo3 - mouse gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN506098 | Foxo3 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |