LRP1B Human Gene Knockout Kit (CRISPR)
CAT#: KN224195
LRP1B - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12,260.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | LRP1B |
Locus ID | 53353 |
Kit Components |
KN224195G1, LRP1B gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CGGGATTATTGCCGATTGCC KN224195G2, LRP1B gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CGTGGGAGCCGACCGAGGTA KN224195-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_018557 |
Synonyms | LRP-DIT; LRPDIT |
Summary | This gene encodes a member of the low density lipoprotein (LDL) receptor family. These receptors play a wide variety of roles in normal cell function and development due to their interactions with multiple ligands. Disruption of this gene has been reported in several types of cancer. [provided by RefSeq, Jun 2016] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN224195BN | LRP1B - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN224195LP | LRP1B - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN224195RB | LRP1B - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN424195 | LRP1B - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |
|
GA110009 | LRP1B CRISPRa kit - CRISPR gene activation of human LDL receptor related protein 1B |
CNY 12,255.00 |