TAP2 Human Gene Knockout Kit (CRISPR)
CAT#: KN222611BN
TAP2 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12,260.00
CNY 3,710.00
CNY 7,288.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
Donor DNA | mBFP-Neo |
Symbol | TAP2 |
Locus ID | 6891 |
Kit Components |
KN222611G1, TAP2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TGGTGGACGCGGCTTTACTG KN222611G2, TAP2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGGGGACTTTGCTTCCTCAA KN222611BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_000544, NM_001290043, NM_018833 |
Synonyms | ABC18; ABCB3; APT2; D6S217E; PSF-2; PSF2; RING11 |
Summary | The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene is located 7 kb telomeric to gene family member ABCB2. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with ABCB2 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Alternative splicing of this gene produces products which differ in peptide selectivity and level of restoration of surface expression of MHC class I molecules. [provided by RefSeq, Feb 2014] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN222611 | TAP2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN222611LP | TAP2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN222611RB | TAP2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN422611 | TAP2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |
|
GA104749 | TAP2 CRISPRa kit - CRISPR gene activation of human transporter 2, ATP binding cassette subfamily B member |
CNY 12,255.00 |