ROR1 Human Gene Knockout Kit (CRISPR)

CAT#: KN214967BN

ROR1 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12,260.00


货期*
6周

规格
    • 1 kit

Product images

经常一起买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


ROR1 mouse monoclonal antibody, clone OTI3D11 (formerly 3D11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


ROR1 (Myc-DDK-tagged)-Human receptor tyrosine kinase-like orphan receptor 1 (ROR1), transcript variant 1
    • 10 ug

CNY 10,296.00

Specifications

Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA mBFP-Neo
Symbol ROR1
Locus ID 4919
Kit Components

KN214967G1, ROR1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GCTGCTGCTGGCCGCACGCG

KN214967G2, ROR1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ATGCACCGGCCGCGCCGCCG

KN214967BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001083592, NM_005012
Synonyms dJ537F10.1; NTRKR1
Summary This gene encodes a receptor tyrosine kinase-like orphan receptor that modulates neurite growth in the central nervous system. The encoded protein is a glycosylated type I membrane protein that belongs to the ROR subfamily of cell surface receptors. It is a pseudokinase that lacks catalytic activity and may interact with the non-canonical Wnt signalling pathway. This gene is highly expressed during early embryonic development but expressed at very low levels in adult tissues. Increased expression of this gene is associated with B-cell chronic lymphocytic leukaemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...