LIN28B Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA	GFP-puro
Symbol	LIN28B
Locus ID	389421
Kit Components	KN213537G1, LIN28B gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCGTGGGGCAACATGGCCGA KN213537G2, LIN28B gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TAGAAAAGAAAATTAACCTT KN213537-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_001004317
Synonyms	CSDD2
Summary	The protein encoded by this gene belongs to the lin-28 family, which is characterized by the presence of a cold-shock domain and a pair of CCHC zinc finger domains. This gene is highly expressed in testis, fetal liver, placenta, and in primary human tumors and cancer cell lines. It is negatively regulated by microRNAs that target sites in the 3' UTR, and overexpression of this gene in primary tumors is linked to the repression of let-7 family of microRNAs and derepression of let-7 targets, which facilitates cellular transformation. [provided by RefSeq, Jun 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.