Eph receptor B4 (EPHB4) Human Gene Knockout Kit (CRISPR)

CAT#: KN208559LP

EPHB4 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12,260.00


货期*
6周

规格
    • 1 kit

Product images

经常一起买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


EPHB4 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


EPHB4 (Myc-DDK-tagged)-Human EPH receptor B4 (EPHB4)
    • 10 ug

CNY 7,232.00

Specifications

Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA Luciferase-Puro
Symbol Eph receptor B4
Locus ID 2050
Kit Components

KN208559G1, Eph receptor B4 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCTTCGTTGGCCGCAGCTT

KN208559G2, Eph receptor B4 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGGTGAGTTTCCTTGCGGGG

KN208559LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_004444
Synonyms HTK; MYK1; TYRO11
Summary Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...