MAT1A Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA	GFP-puro
Symbol	MAT1A
Locus ID	4143
Kit Components	KN203765G1, MAT1A gRNA vector 1 in pCas-Guide CRISPR vector KN203765G2, MAT1A gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGACTCCTTCACTTAGAGAG KN203765-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_000429
Synonyms	MAT; MATA1; SAMS; SAMS1
Summary	This gene catalyzes a two-step reaction that involves the transfer of the adenosyl moiety of ATP to methionine to form S-adenosylmethionine and tripolyphosphate, which is subsequently cleaved to PPi and Pi. S-adenosylmethionine is the source of methyl groups for most biological methylations. The encoded protein is found as a homotetramer (MAT I) or a homodimer (MAT III) whereas a third form, MAT II (gamma), is encoded by the MAT2A gene. Mutations in this gene are associated with methionine adenosyltransferase deficiency. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.