STAT1 Human Gene Knockout Kit (CRISPR)
CAT#: KN201075BN
STAT1 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12,260.00
CNY 3,710.00
CNY 1,999.00
CNY 2,700.00
CNY 8,240.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
Donor DNA | mBFP-Neo |
Symbol | STAT1 |
Locus ID | 6772 |
Kit Components |
KN201075G1, STAT1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AAAGCTGGTGAACCTGCTCC KN201075G2, STAT1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCAGCTTGACTCAAAATTCC KN201075BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_007315, NM_139266 |
Synonyms | CANDF7; IMD31A; IMD31B; IMD31C; ISGF-3; STAT91 |
Summary | The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. The protein encoded by this gene can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. The protein plays an important role in immune responses to viral, fungal and mycobacterial pathogens. Mutations in this gene are associated with Immunodeficiency 31B, 31A, and 31C. [provided by RefSeq, Jun 2020] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN201075 | STAT1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN201075LP | STAT1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN201075RB | STAT1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN401075 | STAT1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |
|
GA104659 | STAT1 CRISPRa kit - CRISPR gene activation of human signal transducer and activator of transcription 1 |
CNY 12,255.00 |