Sodium Potassium ATPase (ATP1A1) Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA	mBFP-Neo
Symbol	Sodium Potassium ATPase
Locus ID	476
Kit Components	KN201009G1, Sodium Potassium ATPase gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTGAGTGTCCGGCGCGCCCG KN201009G2, Sodium Potassium ATPase gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGAAGTCGGGAGGGCGACCG KN201009BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_000701, NM_001001586, NM_001160233, NM_001160234
Synonyms	MGC3285; MGC51750
Summary	The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.