Mouse Xist activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Xist
Locus ID	213742
Kit Components	GA213173G1, Xist gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTTCTAGTGTCCAAGACG GA213173G2, Xist gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATAATATAGTTAGACCTAA GA213173G3, Xist gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGCAATTCTGACATCTTAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NR_001463, NR_001570
Summary	X inactivation is an early developmental process in mammalian females that transcriptionally silences one of the pair of X chromosomes, thus providing dosage equivalence between males and females. The process is regulated by several factors, including a region of chromosome X called the X inactivation center (XIC). The XIC comprises several non-coding and protein-coding genes, and this gene was the first non-coding gene identified within the XIC. This gene is expressed exclusively from the XIC of the inactive X chromosome. It is essential for the initiation and spread of X-inactivation. It silences hundreds of genes by recruiting and tethering repressive chromatin-modifying complexes to the inactive X chromosome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Apr 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.